MSTRG.6816.2

Human non-coding transcript

Responsive image

Reference

Relation to reference Exonic overlap with reference on the opposite strand
Reference ENSEMBL ID ENST00000614999
Reference alias NBPF14
Biotype of reference transcript protein_coding
Responsive image
Responsive image

lncRNA

Transcript ID MSTRG.6816.2
Chromosome 1
Start 148557541
Stop 148575763
Strand +
Exons 3
Length 835 nt
Protein coding potential Low

Expession

Sample IDExpression
ENCSR896CFV - HepG20.12815
ENCSR066FZL - large intestine3.90084
ENCSR624FBY - HepG20.7020529999999999
ENCSR182DAW - HepG20.813592
ENCSR807ODB - HepG20.466286
ENCSR174OYC - K5621.443347
ENCSR354XQY - HepG21.032784
ENCSR952QDQ - K5620.9264760000000001
ENCSR000CPG - K5626.805807000000001
ENCSR782MXN - HepG20.197229
ENCSR149DMY - K5621.443028
ENCSR957EEG - HepG21.625807
ENCSR453HKS - K5620.671693
ENCSR637JLM - HepG20.927168
ENCSR000CPY - K56238.098579
ENCSR477TRX - HepG20.267968
ENCSR420NLC - PC-312.631203999999999
ENCSR057GCF - HepG20.687126
ENCSR391VGU - heart left ventricle0.8853
ENCSR094GVZ - sigmoid colon3.481208
ENCSR796HLX - tibial nerve7.783658
ENCSR094VRQ - breast epithelium8.530951
ENCSR119QWQ - K5621.3054459999999999
ENCSR647NYX - HepG20.6857409999999999
ENCSR783LUA - K5621.9626299999999999
ENCSR745WVZ - K5620.728571
ENCSR419JMU - K5620.8558370000000001
ENCSR648OSR - tibial nerve6.185124
ENCSR510MIA - esophagus squamous epithelium15.266592000000001
ENCSR201WVA - SK-MEL-54.123688
ENCSR000AEV - urinary bladder7.02902
ENCSR945UYL - HepG20.093462
ENCSR237IWZ - HepG20.432641
ENCSR529QEZ - HepG20.507464
ENCSR861ENA - HepG20.20673000000000002
ENCSR043RSE - H1-hESC0.008842000000000001
ENCSR963RLK - K5620.8395959999999999
ENCSR042GYH - ovary4.845601
ENCSR740YMS - gastroesophageal sphincter0.222504
ENCSR422JMS - HepG20.62766
ENCSR106SZN - spleen13.412063
ENCSR438YPF - breast epithelium10.370732
ENCSR717SJA - K5621.940277
ENCSR361LBE - K5621.478884
ENCSR332DBS - LHCN-M27.869597
ENCSR334BTA - K5625.2725550000000005
ENCSR438MDN - K5621.613777
ENCSR771ZZL - K5621.126177
ENCSR000AEH - GM128780.039263
ENCSR000CPS - K5627.6080309999999995
ENCSR586SYA - body of pancreas7.119965
ENCSR778RWJ - HepG20.946159
ENCSR267RHP - K5621.5487870000000001
ENCSR000CQJ - HeLa-S311.266293
ENCSR644AIM - HepG20.200034
ENCSR898OPN - K5620.772759
ENCSR524YXQ - K5622.292002
ENCSR201WFU - K5620.622836
ENCSR134JRE - K5621.4647139999999998
ENCSR874ZLI - K5620.670046
ENCSR713OLV - HepG20.347568
ENCSR342EDG - K5621.1586290000000001
ENCSR606QIX - K5621.9143720000000002
ENCSR904BCZ - K5621.888884
ENCSR910YNJ - HepG20.570064
ENCSR084SCN - K5621.4410889999999998
ENCSR678WOA - K5620.653927
ENCSR385TMY - HepG20.072383
ENCSR321PGV - lower leg skin7.080424000000001
ENCSR689ZJC - HepG20.20060899999999998
ENCSR376RJN - HepG20.360609
ENCSR454KYR - K5622.4681130000000002
ENCSR856CJK - K5620.427224
ENCSR118EFE - K5621.609076
ENCSR750ETS - esophagus muscularis mucosa1.4120110000000001
ENCSR927JXU - HepG20.384376
ENCSR081EST - K5621.3205040000000001
ENCSR670WQY - H1-hESC0.074412
ENCSR995RPB - HepG21.291631
ENCSR110HAA - HepG20.721021
ENCSR635FRH - HepG20.71432
ENCSR094KBY - HepG21.004118
ENCSR599UDS - K5620.610855
ENCSR460YCS - lower leg skin14.125406
ENCSR000AFN - uterus15.496323
ENCSR000CQG - endothelial cell of umbilical vein18.095115
ENCSR971KNW - MG632.27195
ENCSR000AAU - smooth muscle cell of the umbilical artery11.640665
ENCSR648QFY - K5622.1170139999999997
ENCSR000CQP - SK-N-SH2.669648
ENCSR620PUP - K5621.807147
ENCSR318HAT - HepG20.780741
ENCSR164TLB - K5622.1346529999999997
ENCSR000CTM - A5491.384235
ENCSR459EMR - HepG20.49664899999999995
ENCSR671WMH - subcutaneous adipose tissue17.822069
ENCSR110BDY - cardiac atrium fibroblast0.537776
ENCSR490DYI - HepG20.076442
ENCSR998RZI - HepG21.549069
ENCSR471RUK - stomach9.275069
ENCSR000CUF - osteoblast4.3011610000000005
ENCSR000CPL - keratinocyte1.425295
ENCSR880DEH - HepG21.128666
ENCSR194HVU - spleen20.680985
ENCSR227AVS - K5621.0874059999999999
ENCSR946OFN - HepG20.40876999999999997
ENCSR000CUO - mesenchymal stem cell of Wharton's jelly3.594323
ENCSR000AAN - smooth muscle cell of the pulmonary artery4.381408
ENCSR000CPU - mammary epithelial cell2.063075
ENCSR398LZW - HepG20.816233
ENCSR357XTU - natural killer cell39.300270000000005
ENCSR000CVT - GM128789.771285
ENCSR000CTZ - mesenchymal stem cell of adipose12.181977
ENCSR449GLL - B cell14.046991
ENCSR450BNZ - Peyer's patch7.64155
ENCSR079IPT - K5623.816217
ENCSR828TEI - myotube3.968454
ENCSR570CWH - HepG20.504865
ENCSR046XHI - ovary1.4876639999999999
ENCSR584LDM - K5621.317596
ENCSR696LLZ - HepG20.25791
ENCSR792XFP - K5620.934048
ENCSR000CPH - K5620.702677
ENCSR843LYF - K5621.09806
ENCSR000CUQ - melanocyte of skin3.2380400000000003
ENCSR016IDR - HepG20.18653
ENCSR028YAQ - HepG20.752203
ENCSR794NUE - K5621.0909739999999999
ENCSR544SAU - Peyer's patch16.250207
ENCSR318OXM - HepG20.27322199999999996
ENCSR368ZRP - K5624.722493
ENCSR675KPR - K5621.512038
ENCSR517JDK - HepG20.632642
ENCSR906RHU - K5621.501311
ENCSR960MSV - HepG20.49184300000000003
ENCSR558XNA - K5622.178068
ENCSR584JRB - HepG20.180126
ENCSR000COQ - GM128780.447008
ENCSR384BDV - K5622.1856240000000002
ENCSR104ABF - HepG20.307448
ENCSR620HAA - HepG20.587253
ENCSR040FSN - K5621.334632
ENCSR701TST - prostate gland7.407610000000001
ENCSR837QDN - HepG20.489486
ENCSR968WKR - bipolar neuron0.640546
ENCSR308IKH - HepG20.6522140000000001
ENCSR660MZN - HepG20.601824
ENCSR314LXG - Karpas-4223.926996
ENCSR878EUT - glomerular endothelial cell1.140202
ENCSR334HNJ - K5621.527436
ENCSR000AFH - spinal cord6.254149
ENCSR653DFZ - G4011.628536
ENCSR245BNJ - K5622.07789
ENCSR017PRS - HepG20.12192
ENCSR351CNN - K5621.289515
ENCSR000AEW - cerebellum4.726344999999999
ENCSR471GIS - HepG21.0579100000000001
ENCSR648BSC - HepG21.281709
ENCSR478FJK - HepG20.490859
ENCSR000CTT - SK-N-SH0.032113
ENCSR620LQN - esophagus muscularis mucosa3.964927
ENCSR109IQO - K5622.430671
ENCSR000CTL - A5490.031782
ENCSR942UNX - K5621.406855
ENCSR034RPU - foreskin keratinocyte2.179378
ENCSR313COD - upper lobe of left lung2.493128
ENCSR118XYK - K5621.2578129999999998
ENCSR000CQA - K5627.49608
ENCSR000CPB - endothelial cell of umbilical vein12.034286
ENCSR118TVR - epithelial cell of proximal tubule3.05405
ENCSR060KRD - K5621.674355
ENCSR023HWI - K5622.2268779999999997
ENCSR448DCX - urinary bladder0.363648
ENCSR011BBS - HepG20.43549899999999997
ENCSR495HDM - prostate gland13.540742000000002
ENCSR081XRA - K5622.16743
ENCSR984CLJ - K5621.808388
ENCSR929PXS - HepG20.408553
ENCSR486AIO - HepG20.26600100000000004
ENCSR210DML - HepG21.2908389999999998
ENCSR167JPY - HepG20.014858000000000001
ENCSR971GPJ - HT-298.77103
ENCSR366FFV - HepG20.085961
ENCSR667PLJ - K5621.563598
ENCSR230ORC - HepG20.10311700000000001
ENCSR968BBQ - HepG20.8516040000000001
ENCSR916WOI - K5620.594494
ENCSR275ZLF - mesenchymal stem cell0.052409000000000004
ENCSR158KFO - omental fat pad5.870280999999999
ENCSR504VXC - A3757.390851
ENCSR031RZS - K5624.349634
ENCSR663WGC - mesenchymal stem cell0.141483
ENCSR844QNT - K5620.953045
ENCSR047EEG - K5621.2551809999999999
ENCSR906WTM - HepG20.823624
ENCSR841ADZ - ovary7.401403
ENCSR035SKV - gastroesophageal sphincter2.115104
ENCSR367AIV - foreskin keratinocyte0.004005
ENCSR997FOT - HepG20.235312
ENCSR154OBA - K5621.708019
ENCSR274KWA - HepG20.8745290000000001
ENCSR410UHJ - HepG20.7346520000000001
ENCSR952RRH - K5621.139998
ENCSR234YMW - K5621.03084
ENCSR538QOG - HepG20.568553
ENCSR000CPC - HepG22.0910830000000002
ENCSR040WAK - HepG20.274241
ENCSR030ARO - HepG21.181683
ENCSR042QTH - HepG20.493546
ENCSR519KXM - HepG20.094941
ENCSR919QJT - H41.218043
ENCSR279HMU - HepG20.812566
ENCSR028ITN - HepG20.575041
ENCSR762FEO - K5621.458879
ENCSR556FNN - K5620.276855
ENCSR897KTO - epithelial cell of alveolus of lung0.692461
ENCSR117WLY - K5625.3415550000000005
ENCSR000CQH - endothelial cell of umbilical vein29.571257
ENCSR744YVR - HepG20.166659
ENCSR113PYX - K5623.470071
ENCSR244ISQ - neural progenitor cell4.714794
ENCSR118VQR - HepG20.775417
ENCSR000CTO - MCF-78.58618
ENCSR560RSZ - K5622.1831669999999996
ENCSR047AJA - K5621.246558
ENCSR708GKW - HepG20.8238629999999999
ENCSR603TCV - HepG20.034645999999999996
ENCSR305XWT - HepG20.643183
ENCSR000CQM - K5623.5562400000000003
ENCSR398HXV - K5621.217352
ENCSR891AXF - K5621.23558
ENCSR424QCW - K5620.304627
ENCSR191VWK - K5620.8757889999999999
ENCSR719PXC - ascending aorta1.108279
ENCSR000COO - fibroblast of lung4.204976
ENCSR608IAI - K5621.396576
ENCSR688GVV - K5621.440269
ENCSR124KCF - HepG20.136006
ENCSR635BOO - HepG20.307802
ENCSR752UNJ - stomach2.9019220000000003
ENCSR504NIU - subcutaneous adipose tissue26.172962
ENCSR000AFF - skeletal muscle tissue1.378785
ENCSR823WTA - K5621.711166
ENCSR527IVX - K5621.172765
ENCSR795VAK - K5621.273765
ENCSR000COY - skeletal muscle myoblast0.353231
ENCSR129RWD - K5621.7874419999999998
ENCSR222CSF - HepG20.76735
ENCSR622MCX - HepG20.543189
ENCSR572EET - neural stem progenitor cell0.470289
ENCSR205VSQ - K5621.023595
ENCSR000AFJ - temporal lobe2.137895
ENCSR448JAM - K5621.001322
ENCSR660ETT - K5621.7731
ENCSR351OTL - esophagus squamous epithelium1.924855
ENCSR815CVQ - K5620.8592069999999999
ENCSR398GHW - K5622.8322950000000002
ENCSR000CPF - HepG20.027226
ENCSR425RGZ - upper lobe of left lung22.165754
ENCSR610AEI - HepG20.187711
ENCSR281IUF - K5621.041974
ENCSR533HXS - HepG21.1663649999999999
ENCSR732ICL - K5621.502743
ENCSR000AFK - thyroid gland7.645312
ENCSR808FBR - HepG20.10971900000000001
ENCSR113HRG - K5621.453875
ENCSR689MIY - HepG20.7388239999999999
ENCSR000CPZ - K5622.02454
ENCSR542ESY - HepG21.133677
ENCSR000AEU - liver11.61149
ENCSR568YRP - SJCRH305.785553
ENCSR165VBD - K5623.71196
ENCSR676EKU - HepG20.47662899999999997
ENCSR602AWR - K5621.291925
ENCSR944FLL - CD8-positive alpha-beta T cell4.610499
ENCSR080HPT - omental fat pad5.1941239999999995
ENCSR371VGV - myometrial cell1.1662860000000002
ENCSR066VOO - K5623.886912
ENCSR774BXV - K5621.367422
ENCSR905HID - HepG20.310145
ENCSR827IXS - sigmoid colon2.661059
ENCSR060IWW - HepG20.388853
ENCSR000CUM - subcutaneous preadipocyte2.701291
ENCSR322XVS - K5620.483779
ENCSR000CUJ - fibroblast of the aortic adventitia14.301089000000001
ENCSR000CTU - MCF-70.049565
ENCSR232XRZ - K5620.876132
ENCSR000CQS - endothelial cell of umbilical vein0.143362
ENCSR535VTR - HT10805.209221
ENCSR569JKX - SK-N-DZ0.017463
ENCSR535YPK - K5621.03138
ENCSR681SMT - HepG20.5498109999999999
ENCSR192GBD - K5621.773543
ENCSR325OOM - K5620.8638879999999999
ENCSR000CUI - skeletal muscle satellite cell6.282603
ENCSR706SXN - HepG20.9030879999999999
ENCSR710NWE - HepG20.999582
ENCSR954HAY - K5620.5073
ENCSR812AKX - sigmoid colon1.342368
ENCSR691IVR - HepG20.5945199999999999
ENCSR911DGK - K5622.739776
ENCSR904CJQ - K5622.247217
ENCSR840QFR - HepG20.9277799999999999
ENCSR518JXY - HepG20.302243
ENCSR012DAF - HepG20.308678
ENCSR306EIU - K5621.3356299999999999
ENCSR529MBZ - K5620.614522
ENCSR000AEQ - K5620.071156
ENCSR711ZJQ - HepG21.709328
ENCSR047VPW - HepG20.882834
ENCSR552NBS - K5620.896177
ENCSR244SIO - K5620.797689
ENCSR000AEZ - heart8.135335000000001
ENCSR295XKC - HepG20.2027
ENCSR450VQO - HepG21.184125
ENCSR645TCG - omental fat pad11.313064
ENCSR643UFV - HepG20.370756
ENCSR802HPM - Peyer's patch19.62898
ENCSR000AAM - pulmonary artery endothelial cell1.8087990000000003
ENCSR219DXZ - K5621.604834
ENCSR585KOJ - HepG20.628487
ENCSR000CPJ - keratinocyte21.248626
ENCSR936TED - K5621.84743
ENCSR998MZP - HepG21.821752
ENCSR639LKS - HepG20.20216900000000002
ENCSR812EIA - K5621.182495
ENCSR853PBF - HepG21.532327
ENCSR485WBR - gastroesophageal sphincter4.529485
ENCSR792CBM - K5621.961887
ENCSR693MZJ - HepG20.28270100000000004
ENCSR081QQH - HepG20.8358780000000001
ENCSR457ENP - right atrium auricular region0.582084
ENCSR064DXG - HepG20.740884
ENCSR902WSK - K5621.105417
ENCSR000CPI - keratinocyte20.957186
ENCSR689PHN - HepG20.117155
ENCSR968YWY - HepG20.541762
ENCSR052IYH - HepG21.6387669999999999
ENCSR609NZM - gastrocnemius medialis0.146561
ENCSR000CUG - vein endothelial cell0.247721
ENCSR155BMF - HepG20.994425
ENCSR716WZH - HepG20.205031
ENCSR853ZJS - HepG20.634179
ENCSR801MKV - adrenal gland0.522424
ENCSR000COS - GM128783.985978
ENCSR272UNO - tibial nerve6.9069460000000005
ENCSR624OUI - K5622.235909
ENCSR629EWX - K5621.0766850000000001
ENCSR000CPX - fibroblast of lung13.779335999999999
ENCSR232CPD - K5621.107747
ENCSR067UNX - HT10807.355351
ENCSR853WOM - stomach3.435389
ENCSR480SLD - suprapubic skin19.875870000000003
ENCSR000CPK - keratinocyte0.023377000000000002
ENCSR164MUK - K5620.594921
ENCSR611ZAL - K5625.956981
ENCSR409CSO - HepG21.0266030000000002
ENCSR302JQA - K5620.7960020000000001
ENCSR837ZLY - thoracic aorta9.885511
ENCSR858QEL - tibial nerve8.438417
ENCSR220TBR - HepG20.413307
ENCSR829EFL - K5625.00646
ENCSR079LMZ - K5620.929651
ENCSR000COV - H1-hESC0.5891
ENCSR000CQB - MCF-7123.478297
ENCSR463JBR - CD4-positive helper T cell9.268993
ENCSR770OWW - K5620.8211290000000001
ENCSR256PLH - K5621.278851
ENCSR000AEC - GM128780.144581
ENCSR000CPM - fibroblast of lung0.593276
ENCSR577XBW - K5622.51939
ENCSR118KUN - HepG21.14393
ENCSR744PAQ - HepG20.595936
ENCSR146LBD - vagina23.55635
ENCSR341PZW - K5621.902464
ENCSR825QXH - HepG20.592859
ENCSR108MAU - suprapubic skin16.626904999999997
ENCSR800WIY - transverse colon17.257979000000002
ENCSR000AEO - K5620.379704
ENCSR007XKL - K5620.924323
ENCSR457WBK - HepG20.20033499999999999
ENCSR995JMS - HepG20.31340999999999997
ENCSR866XLI - K5621.081124
ENCSR000CPR - HeLa-S32.317793
ENCSR336DFS - K5621.0759940000000001
ENCSR715XZS - K5621.2541879999999999
ENCSR000AEM - K5621.229422
ENCSR137HKS - K5621.214053
ENCSR000CQO - keratinocyte18.017675
ENCSR551NII - lower leg skin43.649161
ENCSR701GSV - HepG20.059503
ENCSR345VVZ - K5620.8017920000000001
ENCSR634KHL - HepG20.362599
ENCSR777EDL - K5621.2700770000000001
ENCSR492BKM - K5622.885257
ENCSR770LYW - K5620.695386
ENCSR784FTX - HepG20.6643439999999999
ENCSR000CTK - IMR-908.243641
ENCSR000CQC - A5497.084873
ENCSR000CPQ - HeLa-S323.367539
ENCSR572FFX - K5621.310722
ENCSR296PMS - stomach1.101539
ENCSR945GUR - K5622.24784
ENCSR977XUX - neural stem progenitor cell0.614695
ENCSR813NZP - K5620.841292
ENCSR594DNW - HepG20.266968
ENCSR004OSI - HepG21.042023
ENCSR406SAW - upper lobe of left lung10.658236
ENCSR783YSQ - K5621.163123
ENCSR014VQS - K5622.303563
ENCSR254JJM - Daoy8.603451
ENCSR100SIL - foreskin keratinocyte0.137251
ENCSR369RVN - cardiac ventricle fibroblast1.875188
ENCSR169QQW - K5623.3652330000000004
ENCSR680USE - hair follicular keratinocyte1.673577
ENCSR330UMQ - spleen20.437665
ENCSR003EKR - HepG20.405861
ENCSR182GKG - HepG20.504288
ENCSR188IPO - K5620.773884
ENCSR669KQU - SK-MEL-56.675955
ENCSR355OQC - HepG20.536291
ENCSR000CPN - SK-N-SH0.464563
ENCSR165BCF - K5620.761192
ENCSR850PWM - K5621.7945200000000001
ENCSR331DUD - K5621.8496279999999998
ENCSR185JGT - HepG20.5826819999999999
ENCSR310VND - K5622.333416
ENCSR152IWT - K5620.9885229999999999
ENCSR000CPW - fibroblast of lung14.026682999999998
ENCSR000YYN - K5621.273193
ENCSR504QMK - right lobe of liver6.5635710000000005
ENCSR116QBU - HepG20.634644
ENCSR720BPO - HepG20.157661
ENCSR031RRO - K5621.917714
ENCSR000CUE - articular chondrocyte of knee joint8.087643
ENCSR034VBA - K5621.264744
ENCSR112YTD - K5621.851564
ENCSR424JSU - HepG21.183977
ENCSR835RMN - K5620.529648
ENCSR312SFA - HepG20.687075
ENCSR067LLB - K5623.318875
ENCSR208GPE - K5621.107059
ENCSR222COT - K5621.237573
ENCSR629RUG - HepG29e-06
ENCSR850FEH - HepG20.240517
ENCSR278CHI - HepG21.2653889999999999
ENCSR653ZJF - transverse colon1.655827
ENCSR269SJB - HepG20.636983
ENCSR572AMC - HepG20.365363
ENCSR995ZGJ - HepG20.7632939999999999
ENCSR000CUR - melanocyte of skin1.201457
ENCSR237YZT - HepG20.37462
ENCSR193FFA - HepG20.15628399999999998
ENCSR226KML - right lobe of liver6.924811999999999
ENCSR671IYC - body of pancreas4.505037000000001
ENCSR839ZDH - upper lobe of left lung4.908980000000001
ENCSR891DYO - K5622.289528
ENCSR000CUH - fibroblast of dermis6.959399
ENCSR000CPV - skeletal muscle myoblast11.31152
ENCSR155EZL - K5620.907932
ENCSR000CTQ - IMR-900.346535
ENCSR797BPP - fibroblast of arm1.002508
ENCSR945XKW - HepG20.371208
ENCSR561CBC - K5621.0985719999999999
ENCSR532ZPP - HepG20.6595449999999999
ENCSR292TAP - neural cell0.089318
ENCSR674KDQ - HepG21.033384
ENCSR754WLW - adrenal gland0.489638
ENCSR468ION - HepG23.7443809999999997
ENCSR410MIQ - K5622.0016849999999997
ENCSR874DVZ - K5621.507799
ENCSR281KCL - HepG20.15045899999999998
ENCSR286OKW - K5621.995766
ENCSR495YSS - K5622.222636
ENCSR967JPI - gastrocnemius medialis6.5635520000000005
ENCSR545MEZ - CD4-positive helper T cell6.2907779999999995
ENCSR571RXE - right atrium auricular region1.2248290000000002
ENCSR246SOU - K5621.553927
ENCSR754RJA - K5621.409837
ENCSR580GSX - A1721.77598
ENCSR047IUS - K5621.53502
ENCSR755KOM - HepG20.204258
ENCSR788YGG - K5620.41739899999999996
ENCSR000CQF - GM128783.471137
ENCSR555BCP - adrenal gland3.6842660000000005
ENCSR605MFS - K5623.321475
ENCSR696SMK - M059J0.362935
ENCSR090UMI - HepG20.571014
ENCSR849STR - K5620.867627
ENCSR362HMX - pericardium fibroblast1.5256290000000001
ENCSR447UCG - HepG20.22836900000000002
ENCSR760EGM - HepG20.178748
ENCSR067AUG - HepG20.00984
ENCSR927TSP - K5621.519717
ENCSR967QNT - K5620.975505
ENCSR527SSD - foreskin keratinocyte8.310272
ENCSR000COZ - endothelial cell of umbilical vein1.2849059999999999
ENCSR871BXO - HepG20.700448
ENCSR961WVL - K5621.778197
ENCSR000COW - H1-hESC9.825732
ENCSR464ADT - K5621.1191309999999999
ENCSR978CSQ - K5621.804977
ENCSR586SEE - NCI-H4600.064803
ENCSR620OKS - HepG20.22200999999999999
ENCSR231DXJ - K5621.095037
ENCSR362XMY - K5622.155862
ENCSR597IYB - HepG20.32014699999999996
ENCSR900SGE - spleen35.141402
ENCSR494VSD - HepG20.40483
ENCSR927SLP - HepG20.7610239999999999
ENCSR474TRG - esophagus squamous epithelium12.268336
ENCSR961YAG - K5620.968101
ENCSR597XHH - HepG20.724042
ENCSR385KOY - HepG20.392858
ENCSR000CQK - HepG24.499053
ENCSR528ZKN - gastroesophageal sphincter2.242022
ENCSR576GOW - HepG22.109797
ENCSR634KBO - K5621.289339
ENCSR306IOF - K5620.861016
ENCSR243IGA - HepG20.8484520000000001
ENCSR485ZTC - HepG21.35704
ENCSR470PRV - K5620.807862
ENCSR386YEV - K5620.43120299999999995
ENCSR385UPQ - K5622.497407
ENCSR985KAT - HepG20.45440200000000003
ENCSR598GKQ - HepG20.342097
ENCSR769GES - HepG20.404004
ENCSR921KDS - K5622.37285
ENCSR116YMU - HepG20.402887
ENCSR492UFS - HepG20.116218
ENCSR767LLP - HepG20.10593499999999999
ENCSR857WJK - sigmoid colon5.557494999999999
ENCSR300QFQ - K5621.186831
ENCSR000CQI - HeLa-S313.174999
ENCSR529JNJ - K5621.382642
ENCSR778SIU - K5621.6993779999999998
ENCSR780YFF - K5620.535163
ENCSR077BPR - K5620.62346
ENCSR908ZAS - hepatocyte7.5324100000000005
ENCSR995JXE - neural cell0.33198099999999997
ENCSR030GZQ - HepG20.543916
ENCSR047QHX - K5620.21550300000000003
ENCSR778WPL - K5620.81358
ENCSR444WHQ - skeletal muscle myoblast3.875494
ENCSR630VJN - transverse colon8.795688
ENCSR082UWF - K5620.8582559999999999
ENCSR222LRL - K5622.045571
ENCSR822SUG - airway epithelial cell1.411358
ENCSR746EKS - HepG20.331219
ENCSR667JTA - MCF-712.64477
ENCSR320BRR - RPMI-79510.693675
ENCSR700BEW - mesendoderm0.12478399999999999
ENCSR048BWH - K5621.473452
ENCSR029LGJ - K5621.848434
ENCSR000AAJ - dermis lymphatic vessel endothelial cell0.687276
ENCSR330KHN - HepG20.816512
ENCSR631RFX - K5621.099712
ENCSR947OIM - K5621.8209919999999997
ENCSR862RGX - suprapubic skin17.234326
ENCSR207QGW - K5622.058728
ENCSR129ROE - K5620.139299
ENCSR545AIK - K5621.791881
ENCSR851KEX - HepG20.34637399999999996
ENCSR895BTE - K5622.3185919999999998
ENCSR509LIV - HepG20.631871
ENCSR010ZMZ - HepG20.714841
ENCSR067GHD - HepG20.332972
ENCSR198TKA - mesangial cell0.911149
ENCSR000CPE - HepG20.506392
ENCSR482VRI - small intestine3.5105440000000003
ENCSR560AYQ - K5621.942827
ENCSR712CSN - K5621.390509
ENCSR269HQA - K5622.288723
ENCSR424YSV - HepG20.53325
ENCSR809ISU - K5623.5429660000000003
ENCSR831YGP - K5622.306483
ENCSR912EHP - HepG20.423122
ENCSR388CNS - HepG20.6559699999999999
ENCSR746NIM - K5620.9019229999999999
ENCSR000CUK - thoracic aorta endothelial cell2.36577
ENCSR436QDU - heart left ventricle1.0167110000000001
ENCSR721MXZ - K5620.657759
ENCSR001HHK - OCI-LY74.649478
ENCSR126ARZ - K5620.801243
ENCSR330YOU - HepG21.721695
ENCSR312SRB - K5621.913427
ENCSR500WHE - HepG20.38290799999999997
ENCSR182CBU - esophagus muscularis mucosa0.80887
ENCSR222SMI - HepG20.6389630000000001
ENCSR656DQV - HepG20.674126
ENCSR496ETJ - HepG20.25543299999999997
ENCSR070LJO - HepG21.035301
ENCSR000CPD - HepG211.403355
ENCSR164OCT - NCI-H4604.396126000000001
ENCSR000CQR - H1-hESC11.476569
ENCSR000COX - mammary epithelial cell0.38959099999999997
ENCSR577OVP - K5620.774226
ENCSR000CUA - hematopoietic multipotent progenitor cell3.9188709999999998
ENCSR896MMU - HepG20.166703
ENCSR907UTB - K5620.688808
ENCSR000AEN - K5621.695418
ENCSR611LQB - K5620.149344
ENCSR810JYX - HepG20.5196270000000001
ENCSR628JYB - K5622.50264
ENCSR810FHY - K5621.98803
ENCSR147ZBD - HepG21.069872
ENCSR678TMV - gastrocnemius medialis0.8652290000000001
ENCSR354QPN - esophagus squamous epithelium4.846429
ENCSR246RRQ - HepG20.406878
ENCSR973QSV - K5621.050597
ENCSR718EWL - K5621.6959669999999998
ENCSR599PXD - HepG20.294396
ENCSR894WMQ - myocyte3.57116
ENCSR573UBF - HepG20.387655
ENCSR000COP - foreskin fibroblast2.420743
ENCSR372UWV - HepG20.317589
ENCSR729CAZ - omental fat pad4.550457
ENCSR410ZPU - K5622.0920099999999997
ENCSR620NSN - bronchus fibroblast of lung0.948357
ENCSR913ZWR - HepG20.833557
ENCSR150QJY - subcutaneous adipose tissue8.956772
ENCSR775TMW - K5620.426457
ENCSR618IQH - K5621.796372
ENCSR000AFG - skin of body22.508402
ENCSR389HFU - HepG20.717539
ENCSR000CTP - IMR-907.446707000000001
ENCSR781YNI - HepG20.656241
ENCSR373KOF - K5621.6879810000000002
ENCSR300IEW - HepG20.43818599999999996
ENCSR563YIS - K5621.44383
ENCSR000AAL - nasal cavity respiratory epithelium epithelial cell of viscerocranial mucosa0.9492280000000001
ENCSR180XTP - HepG20.844993
ENCSR771QMJ - HepG20.561195
ENCSR694LKY - K5620.9390229999999999
ENCSR562CCA - K5621.505254
ENCSR139BIJ - K5620.871281
ENCSR610VTA - HepG20.46619399999999994
ENCSR840QOH - HepG20.29618
ENCSR000AEX - diencephalon0.51162
ENCSR481YXD - K5621.463282
ENCSR919MZM - endometrial microvascular endothelial cells0.519968
ENCSR222ABK - K5620.430654
ENCSR000AAQ - renal cortical epithelial cell3.2773769999999995
ENCSR004RGI - K5620.9967360000000001
ENCSR347ZHQ - HepG20.907293
ENCSR403SZN - transverse colon0.859549
ENCSR958NDU - K5621.463582
ENCSR910ECL - HepG20.516913
ENCSR000AEE - GM128780.136942
ENCSR056QEW - K5626.419188
ENCSR555LCE - K5620.41391300000000003
ENCSR364GRM - HepG20.276418
ENCSR000AAS - smooth muscle cell of trachea9.415196
ENCSR143UET - K5620.7495069999999999
ENCSR000CON - A5492.456633
ENCSR000AAV - uterine smooth muscle cell6.336485
ENCSR071ZLM - uterus4.1028459999999995
ENCSR885YOI - K5621.466253
ENCSR239BCO - K5621.732741
ENCSR408SDL - K5621.565286
ENCSR309HXK - HepG21.021169
ENCSR000COU - H1-hESC0.394401
ENCSR343DHN - HepG20.554721
ENCSR000CUL - fibroblast of villous mesenchyme2.8444700000000003
ENCSR936VPP - K5621.627308
ENCSR098NHI - K5620.481571
ENCSR379YAE - cardiac muscle cell2.7523150000000003
ENCSR000AFA - metanephros22.5172
ENCSR613SLA - foreskin keratinocyte0.022219
ENCSR253DCB - K5622.293078
ENCSR490SQH - H7-hESC2.025516
ENCSR009PPI - HepG20.379305
ENCSR376FGR - HepG20.030121
ENCSR092WKG - K5621.185517
ENCSR395FYF - K5620.761916
ENCSR491FOC - HepG21.013085
ENCSR000CTX - pericyte cell6.531651
ENCSR898NWE - K5621.402947
ENCSR684HTV - HepG20.794304
ENCSR000AEL - K5620.625779
ENCSR312HJY - K5622.5624689999999997
ENCSR914WQV - HepG20.449588
ENCSR152MON - HepG20.9102790000000001
ENCSR000CUN - mammary epithelial cell4.061959
ENCSR708VVE - subcutaneous adipose tissue10.021499
ENCSR000AFD - occipital lobe0.792875
ENCSR296ERI - HepG20.27575
ENCSR494UDF - K5620.647521
ENCSR000CTR - SK-N-SH0.016615
ENCSR000AHH - heart4.4442
ENCSR511SYK - HepG22.4701779999999998
ENCSR625QJI - NCI-H4604.474116
ENCSR697GLD - K5621.368695
ENCSR392HSJ - K5620.576102
ENCSR000AEY - frontal cortex0.18379600000000001
ENCSR032YMP - K5620.583665
ENCSR000CTS - SK-N-SH1.118788
ENCSR313CHR - HepG20.38710500000000003
ENCSR820ROH - HepG20.478963
ENCSR426UUG - HepG20.17261400000000002
ENCSR000CUD - mesenchymal stem cell of the bone marrow24.416233
ENCSR000AFI - stomach14.78418
ENCSR942MBU - HepG21.368863
ENCSR101OPF - K5622.822724
ENCSR728BOL - HepG20.099951
ENCSR000KYM - K5623.116939
ENCSR627NVU - K5622.198227
ENCSR530BOP - K5621.021304
ENCSR374NMJ - HepG21.228126
ENCSR905LVO - CD14-positive monocyte29.47567
ENCSR624XHG - K5620.865347
ENCSR838SMC - HepG20.786361
ENCSR674KEK - HepG20.445912
ENCSR997HCQ - HepG20.37038499999999996
ENCSR000COT - H1-hESC8.823030000000001
ENCSR081IAO - HepG20.972577
ENCSR958KSY - HepG20.27165300000000003
ENCSR346DZQ - K5621.1068360000000002
ENCSR678MVE - K5622.294512
ENCSR850CKU - HepG20.396102
ENCSR251ABP - K5622.544073
ENCSR861QKF - CD8-positive alpha-beta T cell7.1615899999999995
ENCSR695XOD - HepG20.32260900000000003
ENCSR000CPA - endothelial cell of umbilical vein0.00634
ENCSR883BXR - HepG20.343851
ENCSR344XID - K5622.2512939999999997
ENCSR517JHY - K5621.1952040000000002
ENCSR812TLY - K5622.7808189999999997
ENCSR082YGI - HepG21.0569520000000001
ENCSR105OXX - HepG20.46425
ENCSR192BPV - K5622.0055099999999997
ENCSR110ZYD - HepG20.6706310000000001
ENCSR943LIB - K5621.290746
ENCSR434TEU - breast epithelium12.475825
ENCSR098BUF - esophagus muscularis mucosa1.062322
ENCSR667RIA - HepG21.331448
ENCSR148MQK - HepG20.653277
ENCSR136WGP - SK-N-DZ0.126197
ENCSR181RLB - K5621.7868669999999998
ENCSR527QNC - HepG20.48949499999999996
ENCSR000AAI - dermis blood vessel endothelial cell0.165995
ENCSR233IJT - astrocyte5.973682
ENCSR938LSP - GM233383.038569
ENCSR913CAE - K5621.821023
ENCSR661HEL - K5621.2198639999999998
ENCSR732IYM - HepG20.7265159999999999
ENCSR528ASX - K5621.352963
ENCSR000AAR - tracheal epithelial cell3.87189
ENCSR052FJA - smooth muscle cell5.857951
ENCSR511BNY - K5620.445738
ENCSR991HIR - lower leg skin20.868211
ENCSR309PPC - K5621.0642690000000001
ENCSR959LTT - foreskin keratinocyte1.8911639999999998
ENCSR925RNE - K5622.3299119999999998
ENCSR000AFE - parietal lobe2.291377
ENCSR268JDD - K5620.6845899999999999
ENCSR778AJO - HepG20.270065
ENCSR153GKS - HepG21.135645
ENCSR210KJB - K5621.123316
ENCSR269ZAO - HepG21.120608
ENCSR546MBH - K5621.200226
ENCSR000CPO - GM128786.107832
ENCSR481AYC - HepG20.391966
ENCSR143COQ - K5621.278139
ENCSR373BDG - kidney epithelial cell2.2643720000000003
ENCSR000CQD - foreskin fibroblast7.3851
ENCSR455VZH - HepG20.5641390000000001
ENCSR880EGO - SJSA111.667658
ENCSR310FIS - MCF-72.3166130000000003
ENCSR338CON - K5622.725
ENCSR257NIR - Peyer's patch6.995939999999999
ENCSR000CUB - hair follicle dermal papilla cell4.371484
ENCSR964YTW - HepG20.458241
ENCSR685JXU - HepG20.65032
ENCSR416ZJH - K5621.849981
ENCSR379VXW - K5620.436487
ENCSR450ENK - suprapubic skin58.772293000000005
ENCSR000AFB - liver5.459154
ENCSR000CQE - GM128780.33822199999999997
ENCSR076PMZ - K5620.872497
ENCSR000AAA - aortic smooth muscle cell3.9994339999999995
ENCSR000CPT - MCF-76.250929

Expression with the reduced dimensions
Transcript ID MSTRG.6816.2
Component 1 -0.63103646
Component 2 11.440307
Component 3 -2.8103619
Responsive image

FASTA

>MSTRG.6816.2
TCCTGCAATACATTCAGACAGGGACAGACAAAATAAGCCAATTCACCTACACCCATAACAGTCCACTGTCTAATCCCCACACAGGGATCTCAGGCTCCTCAGCATGAGAACAGGACCATGTGAGAGATATACTTCAGGAGGCCTGAAAGCTGGTCATGATATTCCTTGCTTTGCATCTCAGAACCAAGGGTGAAATATCCCCATTCTGGTAGATCGTTATCCCAAAATCATTTATCCCAAGTTTGTGCAAACAGTTATGCTTTATTGTTCCCATCAGTTCAAAGAAAATGCCCCAGATGATTTCCAGGAGGAAAACTAAAGTATTCAGCCCTGTCTCATCAAATGCCCAGCTCGTTCATGGATGCAAGAATTTTAGACACTGAAATTAGAATGAAGGAGGAAATCTACAAACCCTTGAGTCCAAATCATACTTCTGTGAATTTTTTACATCTGCCTGGGTCCAATGTGCTGAGAGCGGGCTCAGGTTGCCACAGGCATGGCTGGAGACTAGGAATAGAGCCTTGCTCACTGACCCATTTCATGTCTAGGCTTCCAACTGAGACTACAGTTTCATTACAACCTATATGCGCCCATAGGTCCTGCCTGCGGCAATGACGTCTCTCGGGTCAGTAAGGGGCACTTGGAACAGGAATATCACCCCTATCTGGAAGACCAGGTGGAGGCTTATCACCTTCACATAAGGTACTCACTGTCCACGTCAAGAGCCAAGCCAAGGTACTGTTCCTCCAATGAGTAAACAGCACTGCTGTAGGGCTGGCCTAAGTCAGGCAGTTCAAGATAACCTGAAGGAGTCGAATAACATCTATCCAGTGAG

Conservation

Conserved in: 11 species
Not found in: 0 species
Most distant counterpart in: Lemur
Conserved species: Chimp, Bonobo, Gorilla, Orangutan, Rhesus, Crab-eating macaque, Atys, Baboon, Green monkey, Marmoset, Lemur
Not found in:
Responsive image
You are here

Human

MSTRG.6816.2

Counterpart found

Chimp

TCONS_00009681

Exonic Identity 14%

Locus Identity 1%
Counterpart found

Bonobo

TCONS_00002560

Exonic Identity 10%

Locus Identity 4%
Counterpart found

Gorilla

TCONS_00001081

Exonic Identity 15%

Locus Identity 14%
Counterpart found

Orangutan

TCONS_00002995

Exonic Identity 0%

Locus Identity 0%
Counterpart found

Rhesus

TCONS_00002344

Exonic Identity 0%

Locus Identity 61%
Counterpart found

MacacaFascicularis

TCONS_00003851

Exonic Identity 6%

Locus Identity 0%
Counterpart found

Atys

TCONS_00016622

Exonic Identity 33%

Locus Identity 57%
Counterpart found

Baboon

TCONS_00007095

Exonic Identity 16%

Locus Identity 11%
Counterpart found

GreenMonkey

TCONS_00067556

Exonic Identity 5%

Locus Identity 1%
Counterpart found

Marmoset

TCONS_00041287

Exonic Identity 7%

Locus Identity 0%
Counterpart found

Lemur

TCONS_00072314

Exonic Identity 0%

Locus Identity 0%

MSTRG.6816.2

Human non-coding transcript

Open the region of interest in the ENSEMBL Browser

ENSEMBL Browser

Check the reference ENSEMBL
transcript ID

ENSEMBL Transcript

Open the region of interest in the UCSC Genome Browser

UCSC Genome Browser