Human non-coding transcript
| Relation to reference | Complete match of intron chain |
| Reference ENSEMBL ID | ENST00000619449 |
| Reference alias | MALAT1 |
| Biotype of reference transcript | lincRNA |
| Reference Gene ID | ENSG00000251562 |
| Transcript ID | ENST00000619449 |
| Chromosome | 11 |
| Start | 65497766 |
| Stop | 65499609 |
| Strand | + |
| Exons | 3 |
| Length | 794 nt |
| Protein coding potential | Low |
| Sample ID | Sample type | Expression (TPM) |
|---|---|---|
| ENCSR000AEP | K562 | 2515.212263 |
| ENCSR000AEG | GM12878 | 1847.392879 |
| ENCSR000AEQ | K562 | 630.950981 |
| ENCSR000AEH | GM12878 | 369.466619 |
| ENCSR309HXK | HepG2 | 0.21628699999999998 |
| ENCSR925SYZ | HepG2 | 0.109051 |
>ENST00000619449
AGGACTGGGGCCCCGCAACTGGCCTCTCCTGCCCTCTTAAGCGCAGCGCCATTTTAGCAACGCAGAAGCCCGGCGCCGGGAAGCCTCAGCTCGCCTGAAGGTGGTAAACTATACCTACTGTCCCTCAAGAGAACACAAGAAGTGCTTTAAGAGGCGGCGGAAGGTGATCGAATTCCGGTGATGCGAGTTGTTCTCCGTCTATAAATACGCCTCGCCCGAGCTGTGCGGTAGGCATTGAGGCAGCCAGCGCAGGGGCTTCTGCTGAGGGGGCAGGCGGAGCTTGAGGAAACCGCAGATAAGTTTTTTTCTCTTTGAAAGATAGAGATTAATACAACTACTTAAAAAATATAGTCAATAGGTTACTAAGATATTGCTTAGCGTTAAGTTTTTAACGTAATTTTAATAGCTTAAGATTTTAAGAGAAAATATGAAGACTTAGAAGAGTAGCATGAGGAAGGAAAAGATAAAAGGTTTCTAAAACATGACGGAGGTTGAGATGAAGCTTCTTCATGGAGTAAAAAATGTATTTAAAAGAAAATTGAGAGAAAGGACTACAGAGCCCCGAATTAATACCAATAGAAGGGCAATGCTTTTAGATTAAAATGAAGGTGACTTAAACAGCTTAAAGTTTAGTTTAAAAGTTGTAGGTGATTAAAATAATTTGAAGGCGATCTTTTAAAAAGAGATTAAACCGAAGGTGATTAAAAGACCTTGAAATCCATGACGCAGGGAGAATTGCGTCATTTAAAGCCTAGTTAACGCATTTACTAAACGCAGACGAAAATGGAAAGATT
| Disease | PMID | Dysfunction_type | Data source |
| gallbladder cancer | 27420766 | expression | PMC6372806 |
| gastric cancer | 27887846 | expression | PMC6372806 |
| renal cell carcinoma | 25480417 | expression | PMC6372806 |
| gastric cancer | 28942451 | regulated | PMC6372806 |
| endometrial cancer | 27693631 | expression | PMC6372806 |
| esophageal cancer | 25613496 | regulated | PMC6372806 |
| osteosarcoma | 25431257 | regulated | PMC6372806 |
| 25773124 | PMC6372806 | ||
| hepatocellular carcinoma | 28469957 | expression | PMC6372806 |
| osteosarcoma | 28346809 | expression | PMC6372806 |
| renal cell carcinoma | 25600645 | expression | PMC6372806 |
| 28535533 | expression | PMC6372806 | |
| bladder cancer | 24449823 | expression | PMC6372806 |
| gastric cancer | 27259812 | expression | PMC6372806 |
| breast cancer | 28915533 | expression | PMC6372806 |
| breast cancer | 26917489 | regulated | PMC6372806 |
| 26335021 | PMC6372806 | ||
| gastric cancer | 25280565 | expression | PMC6372806 |
| hepatocellular carcinoma | 21678027 | expression | PMC6372806 |
| colorectal cancer | 25025966 | expression | PMC6372806 |
| cholangiocarcinoma | 28059437 | expression | PMC6372806 |
| multiple myeloma | 28295550 | expression | PMC6372806 |
| tongue cancer | 28260102 | expression | PMC6372806 |
| glioma | 26619802 | expression | PMC6372806 |
| cervical cancer | 26242259 | expression | PMC6372806 |
| colorectal cancer | 25446987 | expression | PMC6372806 |
| mantle cell lymphoma | 27998273 | expression | PMC6372806 |
| cervical cancer | 26798987 | expression | PMC6372806 |
| colorectal cancer | 28069878 | expression | PMC6372806 |
| thyroid cancer | 27470543 | expression | PMC6372806 |
| bladder cancer | 28648755 | expression | PMC6372806 |
| oral squamous cell carcinoma | 28926115 | expression | PMC6372806 |
| hepatocellular carcinoma | 28543721 | expression | PMC6372806 |
| prostate cancer | 23845456 | expression | PMC6372806 |
| gastric cancer | 28276823 | expression | PMC6372806 |
| bladder cancer | 23153939 | expression | PMC6372806 |
| non-small-cell lung cancer | 25217850 | expression | PMC6372806 |
| renal cell carcinoma | 27655020 | expression | PMC6372806 |
| choriocarcinoma | 29096355 | expression | PMC6372806 |
| oral squamous cell carcinoma | 26522444 | expression | PMC6372806 |
| breast cancer | 27197265 | expression | PMC6372806 |
| lung cancer | 23243023 | expression | PMC6372806 |
| hypertension | 28056547 | expression | PMC6372806 |
| hepatocellular carcinoma | 24468535 | expression | PMC6372806 |
| pancreatic cancer | 25269958 | expression | PMC6372806 |
| osteosarcoma | 26575981 | expression | PMC6372806 |
| breast cancer | 26676637 | expression | PMC6372806 |
| thyroid cancer | 28543663 | expression | PMC6372806 |
| hepatocellular carcinoma | 28720061 | expression | PMC6372806 |
| multiple myeloma | 25187517 | expression | PMC6372806 |
| tongue cancer | 27586393 | expression | PMC6372806 |
| gastric cancer | 28268166 | expression | PMC6372806 |
| calcific aortic valve disease | 28522163 | expression | PMC6372806 |
| esophageal cancer | 26493997 | expression | PMC6372806 |
| pancreatic cancer | 28701723 | expression | PMC6372806 |
| osteosarcoma | 28098894 | expression | PMC6372806 |
| liver fibrosis | 26435214 | expression | PMC6372806 |
| endometrial cancer | 25085246 | regulated | PMC6372806 |
| nasopharyngeal carcinoma | 27584791 | regulated | PMC6372806 |
| esophageal cancer | 27935117 | expression | PMC6372806 |
| colorectal cancer | 29436635 | expression | PMC6372806 |
| lung cancer | 28615056 | regulated | PMC6372806 |
| esophageal cancer | 27470544 | expression | PMC6372806 |
| glioma | 26938295 | expression | PMC6372806 |
| osteoarthritis | 28590075 | expression | PMC6372806 |
| hepatocellular carcinoma | 28722813 | expression | PMC6372806 |
| 29051139 | expression | PMC6372806 | |
| gallbladder cancer | 29058818 | expression | PMC6372806 |
| retinoblastoma | 29073720 | expression | PMC6372806 |
| diabetes mellitus | 29110299 | expression | PMC6372806 |
| 22487937 | expression | PMC6372806 | |
| multiple myeloma | 24583225 | expression | PMC6372806 |
| Parkinson's disease | 27021022 | expression | PMC6372806 |
| glioma | 29202181 | expression | PMC6372806 |
| osteosarcoma | 29204769 | expression | PMC6372806 |
| multiple myeloma | 29214735 | expression | PMC6372806 |
| non-small-cell lung cancer | 29215698 | expression | PMC6372806 |
| pancreatic cancer | 29215734 | expression | PMC6372806 |
| colon cancer | 29226325 | expression | PMC6372806 |
| 29227193 | expression | PMC6372806 | |
| 29258822 | expression | PMC6372806 | |
| 29274336 | expression | PMC6372806 | |
| osteosarcoma | 29290771 | expression | PMC6372806 |
| esophageal squamous cell carcinoma | 25538231 | regulation | PMC5753334 |
| gallbladder cancer | 24658096 | regulation | PMC5753334 |
| colon cancer | 25546229 | regulation | PMC5753334 |
| colorectal cancer | 25031737 | regulation | PMC5753334 |
| bladder cancer | 24373479 | regulation | PMC5753334 |
| breast cancer | 22492512 | regulation | PMC5753334 |
| breast cancer | 22996375 | regulation | PMC5753334 |
| breast cancer | 24499465 | regulation | PMC5753334 |
| cancer | 23463798 | regulation | PMC5753334 |
| cancer | 24757675 | regulation | PMC5753334 |
| tumor | 24721780 | regulation | PMC5753334 |
| prostate cancer | 23726266 | PMC5753334 | |
| cervical cancer | 24932303 | PMC5753334 | |
| pancreatic ductal adenocarcinoma | 24815433 | PMC5753334 | |
| nasopharyngeal carcinoma | 23688988 | PMC5753334 | |
| bladder cancer | 22722759 | PMC5753334 | |
| gastric cancer | 24857172 | PMC5753334 | |
| colorectal cancer | 24244343 | PMC5753334 | |
| melanoma | 24892958 | PMC5753334 | |
| breast cancer | 24525122 | PMC5753334 | |
| neuroblastoma | 24742640 | PMC5753334 | |
| prostate cancer | 22349460 | PMC5753334 | |
| osteosarcoma | 17660802 | PMC5753334 | |
| non-small cell lung cancer | 24313945 | PMC5753334 | |
| multiple myeloma | 25369863 | PMC5753334 | |
| breast cancer | 26918449 | PMC5753334 | |
| breast cancer | 26926567 | PMC5753334 | |
| gastric cancer | 26871474 | PMC5753334 | |
| acute myocardial infarction | 25035150 | PMC5753334 | |
| diabetes mellitus | 25356875 | PMC5753334 | |
| glioblastoma | 25772239 | PMC5753334 | |
| ovarian cancer | 24379988 | PMC5753334 | |
| esophageal squamous cell carcinoma | 27015363 | PMC5753334 | |
| colorectal cancer | 21503572 | PMC5753334 | |
| lung cancer | 22491206 | PMC5753334 | |
| hepatocelluar carcinoma | 22493738 | mutation | PMC5753334 |
| paraspeckle disintegration | 19188602 | mutation | PMC5753334 |
| renal cancer | 26461224 | interaction | PMC5753334 |
| nasopharyngeal carcinoma | 26482776 | interaction | PMC5753334 |
| cervical cancer | 26311052 | interaction | PMC5753334 |
| non-small cell lung cancer | 26265046 | interaction | PMC5753334 |
| lung cancer | 26415832 | interaction | PMC5753334 |
| "hepatocellular carcinoma | |||
| prostate cancer | 26516927 | interaction | PMC5753334 |
| cervical cancer | 20213048 | Interaction | PMC5753334 |
| non-small-cell lung cancer | 25036876 | interaction | PMC5753334 |
| breast cancer | 26191181 | interaction | PMC5753334 |
| pre-eclampsia | 26722461 | interaction | PMC5753334 |
| breast cancer | 26275461 | interaction | PMC5753334 |
| glioma | 26649728 | interaction | PMC5753334 |
| lung adenocarcinoma | 20937273 | interaction | PMC5753334 |
| cervical cancer | 26400521 | expression | PMC5753334 |
| proliferative vitreoretinopathy | 26241674 | expression | PMC5753334 |
| gastric cancer | 26096073 | expression | PMC5753334 |
| non-small cell lung cancer | 26131129 | expression | PMC5753334 |
| non-small cell lung cancer | 22088988 | expression | PMC5753334 |
| triple-negative breast cancer | 25996380 | expression | PMC5753334 |
| hepatocelluar carcinoma | 16878148 | expression | PMC5753334 |
| pancreatic cancer | 25811929 | expression | PMC5753334 |
| pituitary adenoma | 24469926 | expression | PMC5753334 |
| pancreatic cancer | 25481511 | expression | PMC5753334 |
| glioma | 25613066 | expression | PMC5753334 |
| non-small cell lung cancer | 12970751 | expression | PMC5753334 |
| esophageal squamous cell carcinoma | 26406400 | expression | PMC5753334 |
| laryngeal squamous cell carcinoma | 25257554 | expression | PMC5753334 |
| endometrial stromal sarcoma | 16441420 | expression | PMC5753334 |
| bladder cancer | 24006935 | expression | PMC5753334 |
| cancer | 20711585 | expression | PMC5753334 |
| cancer | 20864030 | expression | PMC5753334 |
| cancer | 23660942 | expression | PMC5753334 |
| decreased myogenesis | 23485710 | expression | PMC5753334 |
| diabetes mellitus | 24436191 | expression | PMC5753334 |
| hepatocelluar carcinoma | 17006932 | expression | PMC5753334 |
| hepatocelluar carcinoma | 24183851 | expression | PMC5753334 |
| lung adenocarcinoma | 19690017 | expression | PMC5753334 |
| lung cancer | 24667321 | expression | PMC5753334 |
| non-small cell lung cancer | 21550244 | expression | PMC5753334 |
| non-small cell lung cancer | 21903344 | expression | PMC5753334 |
| non-small cell lung cancer | 22817756 | expression | PMC5753334 |
| osteosarcoma | 20951849 | expression | PMC5753334 |
| small cell lung cancer | 22928560 | expression | PMC5753334 |
| papillary thyroid carcinoma | 25997963 | expression | PMC5753334 |
| neuroblastoma | 20149803 | expression | PMC5753334 |
| lung cancer | 26137228 | expression | PMC5753334 |
| laryngeal squamous cell carcinoma | 24817925 | expression | PMC5753334 |
| Level of interaction | Type | Target | PMID | Data source |
| DNA-TF | regulation | CREB | 20149803 | PMC5753334 |
| RNA-Protein | binding | SR | 20797886 | PMC5753334 |
| RNA-Protein | binding | SR proteins | 20797886 | PMC5753334 |
| RNA-Protein | regulation | SR protein family | 20864030 | PMC5753334 |
| RNA-Protein | regulation | SRSF1 | 20864030 | PMC5753334 |
| RNA-Protein | binding | p54nrb | 21444682 | PMC5753334 |
| RNA-Protein | binding | PSF | 21444682 | PMC5753334 |
| DNA-Protein | regulation | Pc2 | 22078878 | PMC5753334 |
| DNA-Protein | regulation | Pc2 | 22078878 | PMC5753334 |
| RNA-Protein | regulation | RNPS1 | 22355166 | PMC5753334 |
| RNA-Protein | regulation | SRm160 | 22355166 | PMC5753334 |
| RNA-Protein | regulation | IBP160 | 22355166 | PMC5753334 |
| RNA-Protein | regulation | pre-mRNA splicing factors | 23698766 | PMC5753334 |
| RNA-DNA | regulation | Bcl-2 | 25036876 | PMC5753334 |
| RNA-DNA | binding | Sp1 and LTBP3 promoter | 25187517 | PMC5753334 |
| regulation | Cisplatin and paclitaxel | 25257554 | PMC5753334 | |
| RNA-RNA | regulation | SiRNA | 25280565 | PMC5753334 |
| RNA-Protein | regulation | PI3K/AKT signaling pathway | 25431257 | PMC5753334 |
| RNA-RNA | regulation | miR-101 and miR-217 | 25538231 | PMC5753334 |
| RNA-Protein | regulation | CCL5 | 25546229 | PMC5753334 |
| RNA-Protein | regulation | ATM-CHK2 pathway | 25613496 | PMC5753334 |
| RNA-Protein | regulation | RANKL | 25817340 | PMC5753334 |
| regulation | PI3K-AKT pathway | 26191181 | PMC5753334 | |
| RNA-RNA | regulation | miRNA-124 | 26242259 | PMC5753334 |
| RNA-Protein | binding | TDP-43 | 26265046 | PMC5753334 |
| RNA-RNA | regulation | hsa-miR-1 | 26275461 | PMC5753334 |
| RNA-RNA | regulation | miR-145 | 26311052 | PMC5753334 |
| DNA-Protein | regulation | Sp1/3 | 26352013 | PMC5753334 |
| RNA-Protein | regulation | EZH2 (enhancer of zeste homolog 2) and H3K27me3 | 26415832 | PMC5753334 |
| DNA-RNA | regulation | miR-217 | 26415832 | PMC5753334 |
| RNA-RNA | binding | miR-200s | 26461224 | PMC5753334 |
| RNA-RNA | regulation | miR-1 | 26482776 | PMC5753334 |
| RNA-Protein | binding | EZH2 | 26516927 | PMC5753334 |
| RNA-Protein | regulation | N-cadherin, Vimentin, E-cadherin | 26522444 | PMC5753334 |
| RNA-Protein | regulation | ZO-1, occludin and claudin-5 | 26619802 | PMC5753334 |
| RNA-RNA | regulation | miR-140 | 26619802 | PMC5753334 |
| regulation | ERK/MAPK signaling | 26649728 | PMC5753334 | |
| RNA-Protein | regulation | Sox2 and Nestin | 26649728 | PMC5753334 |
| RNA-RNA | regulation | Hsa-miR-1 | 26676637 | PMC5753334 |
| RNA-Protein | regulation | pro-apoptotic proteins including cleaved caspase-3, cleaved caspase-9 and cleaved poly (ADP-ribose) | 26722461 | PMC5753334 |
| RNA-DNA | regulation | PCDH10 | 26871474 | PMC5753334 |
| RNA-Protein | binding | EZH2 | 26871474 | PMC5753334 |
| RNA-RNA | binding | miR-124 | 26918449 | PMC5753334 |
| RNA-DNA | regulation | cyclin-dependent kinase 4 (CDK4) | 26918449 | PMC5753334 |
| RNA-DNA | regulation | cdc42 | 26926567 | PMC5753334 |
| RNA-RNA | binding | miR-1 | 26926567 | PMC5753334 |
| Conserved in: | 10 species |
| Not found in: | 1 species |
| Most distant counterpart in: | Marmoset |
| Conserved species: | Chimp, Bonobo, Gorilla, Orangutan, Rhesus, Crab-eating macaque, Atys, Baboon, Green monkey, Marmoset |
| Not found in: | Lemur |
Human non-coding transcript
Open the region of interest in the ENSEMBL Browser
ENSEMBL BrowserCheck the reference ENSEMBL
transcript ID
Open the region of interest in the UCSC Genome Browser