Human non-coding transcript
| Relation to reference | A transfrag falling entirely within a reference intron |
| Reference ENSEMBL ID | ENST00000610851 |
| Reference alias | MALAT1 |
| Biotype of reference transcript | lincRNA |
| Reference Gene ID | ENSG00000251562 |
| Transcript ID | MSTRG.22374.144 |
| Chromosome | 11 |
| Start | 65505109 |
| Stop | 65505641 |
| Strand | - |
| Exons | 2 |
| Length | 494 nt |
| Protein coding potential | Low |
| Sample ID | Sample type | Expression (TPM) |
|---|---|---|
| ENCSR071ZLM | uterus | 918.694998 |
| ENCSR357XTU | natural killer cell | 800.783826 |
| ENCSR801MKV | adrenal gland | 749.902783 |
| ENCSR857WJK | sigmoid colon | 111.421007 |
| ENCSR000CTK | IMR-90 | 106.50138899999999 |
| ENCSR449GLL | B cell | 89.49448100000001 |
| ENCSR586SYA | body of pancreas | 89.108181 |
| ENCSR625QJI | NCI-H460 | 82.709181 |
| ENCSR905LVO | CD14-positive monocyte | 62.51107 |
| ENCSR555BCP | adrenal gland | 57.64674599999999 |
| ENCSR971KNW | MG63 | 33.288456 |
| ENCSR000CVT | GM12878 | 30.910519 |
| ENCSR255NYQ | SK-N-DZ | 16.485837 |
| ENCSR947OIM | K562 | 13.995351999999999 |
| ENCSR034RPU | foreskin keratinocyte | 13.007338 |
| ENCSR527IVX | K562 | 11.873988 |
| ENCSR403SZN | transverse colon | 11.139998 |
| ENCSR906RHU | K562 | 10.326502 |
| ENCSR113HQM | uterus | 9.67344 |
| ENCSR945XKW | HepG2 | 9.350434 |
| ENCSR253DCB | K562 | 8.797244000000001 |
| ENCSR667JTA | MCF-7 | 8.425523 |
| ENCSR034VBA | K562 | 7.7707619999999995 |
| ENCSR694LKY | K562 | 7.100166000000001 |
| ENCSR844QNT | K562 | 6.968361 |
| ENCSR952RRH | K562 | 6.611775 |
| ENCSR251ABP | K562 | 6.373708000000001 |
| ENCSR900SGE | spleen | 6.065918 |
| ENCSR978CSQ | K562 | 6.065759 |
| ENCSR781YNI | HepG2 | 5.590834 |
| ENCSR538QOG | HepG2 | 5.220515 |
| ENCSR823WTA | K562 | 5.141728 |
| ENCSR643UFV | HepG2 | 4.884454 |
| ENCSR331DUD | K562 | 4.624707 |
| ENCSR618IQH | K562 | 4.577902 |
| ENCSR135LXL | HepG2 | 4.273519 |
| ENCSR851KEX | HepG2 | 4.127581 |
| ENCSR457ENP | right atrium auricular region | 4.0636589999999995 |
| ENCSR334HNJ | K562 | 3.962017 |
| ENCSR424JSU | HepG2 | 3.867925 |
| ENCSR807ODB | HepG2 | 3.7903260000000003 |
| ENCSR628JYB | K562 | 3.7666720000000002 |
| ENCSR866XLI | K562 | 3.748564 |
| ENCSR895BTE | K562 | 3.713657 |
| ENCSR312SFA | HepG2 | 3.6534739999999997 |
| ENCSR239BCO | K562 | 3.3815739999999996 |
| ENCSR712CSN | K562 | 3.171643 |
| ENCSR000CPY | K562 | 3.160699 |
| ENCSR755KOM | HepG2 | 3.114441 |
| ENCSR222COT | K562 | 2.789228 |
| ENCSR802HPM | Peyer's patch | 2.652901 |
| ENCSR695XOD | HepG2 | 2.625669 |
| ENCSR527SSD | foreskin keratinocyte | 2.559396 |
| ENCSR810JYX | HepG2 | 2.53287 |
| ENCSR274KWA | HepG2 | 2.460432 |
| ENCSR450ENK | suprapubic skin | 2.442879 |
| ENCSR000CQA | K562 | 2.420413 |
| ENCSR113HRG | K562 | 2.204821 |
| ENCSR961WVL | K562 | 2.158156 |
| ENCSR124KCF | HepG2 | 2.086103 |
| ENCSR769GES | HepG2 | 2.0656220000000003 |
| ENCSR269SJB | HepG2 | 2.041593 |
| ENCSR076PMZ | K562 | 1.950223 |
| ENCSR563YIS | K562 | 1.891129 |
| ENCSR416ZJH | K562 | 1.8717830000000002 |
| ENCSR385UPQ | K562 | 1.8121029999999998 |
| ENCSR007XKL | K562 | 1.745624 |
| ENCSR000CPG | K562 | 1.705513 |
| ENCSR309HXK | HepG2 | 1.6942409999999999 |
| ENCSR155BMF | HepG2 | 1.6929610000000002 |
| ENCSR959LTT | foreskin keratinocyte | 1.6724580000000002 |
| ENCSR000CPS | K562 | 1.617911 |
| ENCSR237IWZ | HepG2 | 1.512189 |
| ENCSR545AIK | K562 | 1.404842 |
| ENCSR330UMQ | spleen | 1.376543 |
| ENCSR000CQS | endothelial cell of umbilical vein | 1.3630200000000001 |
| ENCSR419JMU | K562 | 1.294877 |
| ENCSR000CPQ | HeLa-S3 | 1.285196 |
| ENCSR070LJO | HepG2 | 1.269962 |
| ENCSR577XBW | K562 | 1.239427 |
| ENCSR831YGP | K562 | 1.2314610000000001 |
| ENCSR201WFU | K562 | 1.225303 |
| ENCSR047AJA | K562 | 1.195765 |
| ENCSR464ADT | K562 | 1.189414 |
| ENCSR379YAE | cardiac muscle cell | 1.182507 |
| ENCSR000KYM | K562 | 1.174754 |
| ENCSR000AEZ | heart | 1.172872 |
| ENCSR000CQH | endothelial cell of umbilical vein | 1.170799 |
| ENCSR685JXU | HepG2 | 1.125365 |
| ENCSR560RSZ | K562 | 1.123165 |
| ENCSR671WMH | subcutaneous adipose tissue | 1.091134 |
| ENCSR372UWV | HepG2 | 1.031506 |
| ENCSR000CQG | endothelial cell of umbilical vein | 1.017104 |
| ENCSR118KUN | HepG2 | 1.016081 |
| ENCSR000CPJ | keratinocyte | 0.9783290000000001 |
| ENCSR000CPB | endothelial cell of umbilical vein | 0.9634889999999999 |
| ENCSR164MUK | K562 | 0.9596809999999999 |
| ENCSR029LGJ | K562 | 0.943976 |
| ENCSR231DXJ | K562 | 0.917423 |
| ENCSR000CPI | keratinocyte | 0.9112370000000001 |
| ENCSR459EMR | HepG2 | 0.892739 |
| ENCSR000CQP | SK-N-SH | 0.8750040000000001 |
| ENCSR495HDM | prostate gland | 0.874817 |
| ENCSR210DML | HepG2 | 0.841931 |
| ENCSR047EEG | K562 | 0.824399 |
| ENCSR174OYC | K562 | 0.815264 |
| ENCSR341PZW | K562 | 0.8118609999999999 |
| ENCSR468ION | HepG2 | 0.8023319999999999 |
| ENCSR040FSN | K562 | 0.792139 |
| ENCSR000CQM | K562 | 0.779652 |
| ENCSR000CPO | GM12878 | 0.778721 |
| ENCSR047IUS | K562 | 0.7742319999999999 |
| ENCSR000CUB | hair follicle dermal papilla cell | 0.7658590000000001 |
| ENCSR495YSS | K562 | 0.756459 |
| ENCSR942UNX | K562 | 0.755538 |
| ENCSR234YMW | K562 | 0.751426 |
| ENCSR000CON | A549 | 0.734957 |
| ENCSR630VJN | transverse colon | 0.7218680000000001 |
| ENCSR453HKS | K562 | 0.6919310000000001 |
| ENCSR081IAO | HepG2 | 0.686678 |
| ENCSR706SXN | HepG2 | 0.682804 |
| ENCSR504NIU | subcutaneous adipose tissue | 0.6816439999999999 |
| ENCSR719PXC | ascending aorta | 0.670609 |
| ENCSR480SLD | suprapubic skin | 0.6664859999999999 |
| ENCSR770LYW | K562 | 0.6637810000000001 |
| ENCSR090UMI | HepG2 | 0.65603 |
| ENCSR194HVU | spleen | 0.653525 |
| ENCSR485WBR | gastroesophageal sphincter | 0.651623 |
| ENCSR000CQI | HeLa-S3 | 0.638991 |
| ENCSR000CPX | fibroblast of lung | 0.616643 |
| ENCSR919MZM | endometrial microvascular endothelial cells | 0.6094609999999999 |
| ENCSR000COO | fibroblast of lung | 0.600503 |
| ENCSR778SIU | K562 | 0.598008 |
| ENCSR000CPR | HeLa-S3 | 0.550974 |
| ENCSR000CQO | keratinocyte | 0.5440159999999999 |
| ENCSR968YWY | HepG2 | 0.540388 |
| ENCSR797BPP | fibroblast of arm | 0.509221 |
| ENCSR605MFS | K562 | 0.49970600000000004 |
| ENCSR000CPC | HepG2 | 0.496914 |
| ENCSR545MEZ | CD4-positive helper T cell | 0.491856 |
| ENCSR572FFX | K562 | 0.471141 |
| ENCSR000CQB | MCF-7 | 0.470951 |
| ENCSR584JRB | HepG2 | 0.459499 |
| ENCSR118EFE | K562 | 0.45498500000000003 |
| ENCSR800WIY | transverse colon | 0.4445 |
| ENCSR000AEN | K562 | 0.42941999999999997 |
| ENCSR000CUN | mammary epithelial cell | 0.413279 |
| ENCSR000CQC | A549 | 0.40849 |
| ENCSR000CPN | SK-N-SH | 0.402376 |
| ENCSR000CQD | foreskin fibroblast | 0.395853 |
| ENCSR109IQO | K562 | 0.394717 |
| ENCSR000CQJ | HeLa-S3 | 0.381384 |
| ENCSR000CPZ | K562 | 0.368093 |
| ENCSR000AEW | cerebellum | 0.36736399999999997 |
| ENCSR444WHQ | skeletal muscle myoblast | 0.36530100000000004 |
| ENCSR862RGX | suprapubic skin | 0.364248 |
| ENCSR312HJY | K562 | 0.361322 |
| ENCSR820ROH | HepG2 | 0.34033800000000003 |
| ENCSR000COQ | GM12878 | 0.340008 |
| ENCSR000CTZ | mesenchymal stem cell of adipose | 0.338566 |
| ENCSR474TRG | esophagus squamous epithelium | 0.337196 |
| ENCSR762FEO | K562 | 0.33615900000000004 |
| ENCSR000CPL | keratinocyte | 0.333012 |
| ENCSR257NIR | Peyer's patch | 0.32251399999999997 |
| ENCSR669KQU | SK-MEL-5 | 0.321845 |
| ENCSR000CPV | skeletal muscle myoblast | 0.32166500000000003 |
| ENCSR894WMQ | myocyte | 0.313915 |
| ENCSR000AAN | smooth muscle cell of the pulmonary artery | 0.313254 |
| ENCSR000AFA | metanephros | 0.311372 |
| ENCSR471RUK | stomach | 0.305213 |
| ENCSR000AAA | aortic smooth muscle cell | 0.303146 |
| ENCSR729CAZ | omental fat pad | 0.29743800000000004 |
| ENCSR000COP | foreskin fibroblast | 0.296111 |
| ENCSR040WAK | HepG2 | 0.293925 |
| ENCSR000AFD | occipital lobe | 0.29344899999999996 |
| ENCSR000CUH | fibroblast of dermis | 0.286679 |
| ENCSR551NII | lower leg skin | 0.274509 |
| ENCSR000CQF | GM12878 | 0.271242 |
| ENCSR732ICL | K562 | 0.266786 |
| ENCSR936TED | K562 | 0.265954 |
| ENCSR528ZKN | gastroesophageal sphincter | 0.264207 |
| ENCSR028YAQ | HepG2 | 0.26400100000000004 |
| ENCSR718EWL | K562 | 0.257775 |
| ENCSR544SAU | Peyer's patch | 0.23822 |
| ENCSR000AEV | urinary bladder | 0.23183600000000001 |
| ENCSR645TCG | omental fat pad | 0.231161 |
| ENCSR675KPR | K562 | 0.217509 |
| ENCSR000CPD | HepG2 | 0.215129 |
| ENCSR908ZAS | hepatocyte | 0.21357600000000002 |
| ENCSR313COD | upper lobe of left lung | 0.200226 |
| ENCSR569JKX | SK-N-DZ | 0.199827 |
| ENCSR000CPT | MCF-7 | 0.195649 |
| ENCSR000AEE | GM12878 | 0.19531800000000002 |
| ENCSR620LQN | esophagus muscularis mucosa | 0.19146400000000002 |
| ENCSR000CUF | osteoblast | 0.187682 |
| ENCSR460YCS | lower leg skin | 0.186256 |
| ENCSR670WQY | H1-hESC | 0.17393599999999998 |
| ENCSR000CPH | K562 | 0.173703 |
| ENCSR000CPU | mammary epithelial cell | 0.166207 |
| ENCSR000AFH | spinal cord | 0.160647 |
| ENCSR000CTS | SK-N-SH | 0.150284 |
| ENCSR000CUE | articular chondrocyte of knee joint | 0.148194 |
| ENCSR098BUF | esophagus muscularis mucosa | 0.14765699999999998 |
| ENCSR000AFB | liver | 0.14711300000000002 |
| ENCSR838SMC | HepG2 | 0.147087 |
| ENCSR425RGZ | upper lobe of left lung | 0.144076 |
| ENCSR150QJY | subcutaneous adipose tissue | 0.132036 |
| ENCSR837ZLY | thoracic aorta | 0.126473 |
| ENCSR000AEU | liver | 0.124901 |
| ENCSR000CQR | H1-hESC | 0.124654 |
| ENCSR158KFO | omental fat pad | 0.12365899999999999 |
| ENCSR000AFI | stomach | 0.12104200000000001 |
| ENCSR314LXG | Karpas-422 | 0.11843699999999999 |
| ENCSR296PMS | stomach | 0.11152000000000001 |
| ENCSR000AFG | skin of body | 0.11126300000000001 |
| ENCSR000CPW | fibroblast of lung | 0.11106700000000001 |
| ENCSR000CUO | mesenchymal stem cell of Wharton's jelly | 0.111035 |
| ENCSR000CUI | skeletal muscle satellite cell | 0.108465 |
| ENCSR827IXS | sigmoid colon | 0.107556 |
| ENCSR880EGO | SJSA1 | 0.10665699999999999 |
| ENCSR406SAW | upper lobe of left lung | 0.105608 |
| ENCSR426UUG | HepG2 | 0.103376 |
| ENCSR000CQK | HepG2 | 0.102959 |
| ENCSR000CUL | fibroblast of villous mesenchyme | 0.10248 |
| ENCSR376FGR | HepG2 | 0.09968099999999999 |
| ENCSR201WVA | SK-MEL-5 | 0.099577 |
| ENCSR000AAS | smooth muscle cell of trachea | 0.095674 |
| ENCSR000COS | GM12878 | 0.09453099999999999 |
| ENCSR504VXC | A375 | 0.092196 |
| ENCSR000AED | GM12878 | 0.089571 |
| ENCSR000AAJ | dermis lymphatic vessel endothelial cell | 0.088839 |
| ENCSR000AEP | K562 | 0.088125 |
| ENCSR000CUJ | fibroblast of the aortic adventitia | 0.084492 |
| ENCSR136WGP | SK-N-DZ | 0.083864 |
| ENCSR000AFK | thyroid gland | 0.083131 |
| ENCSR000AAQ | renal cortical epithelial cell | 0.082355 |
| ENCSR000CTP | IMR-90 | 0.080411 |
| ENCSR529JNJ | K562 | 0.078472 |
| ENCSR000CUK | thoracic aorta endothelial cell | 0.068621 |
| ENCSR094VRQ | breast epithelium | 0.06669 |
| ENCSR000AAV | uterine smooth muscle cell | 0.061576 |
| ENCSR000CPE | HepG2 | 0.058136 |
| ENCSR198TKA | mesangial cell | 0.057308000000000005 |
| ENCSR420NLC | PC-3 | 0.057172 |
| ENCSR754WLW | adrenal gland | 0.054873000000000005 |
| ENCSR000AFE | parietal lobe | 0.054761000000000004 |
| ENCSR000CTX | pericyte cell | 0.054426 |
| ENCSR000AEY | frontal cortex | 0.048734 |
| ENCSR000COU | H1-hESC | 0.047952 |
| ENCSR812AKX | sigmoid colon | 0.047234 |
| ENCSR568YRP | SJCRH30 | 0.045587 |
| ENCSR000AEX | diencephalon | 0.044846 |
| ENCSR839ZDH | upper lobe of left lung | 0.041671 |
| ENCSR000AAL | nasal cavity respiratory epithelium epithelial cell of viscerocranial mucosa | 0.041571 |
| ENCSR000COY | skeletal muscle myoblast | 0.041565 |
| ENCSR281IUF | K562 | 0.040462 |
| ENCSR000CUD | mesenchymal stem cell of the bone marrow | 0.040083999999999995 |
| ENCSR110BDY | cardiac atrium fibroblast | 0.039165 |
| ENCSR000CUM | subcutaneous preadipocyte | 0.036979000000000005 |
| ENCSR434TEU | breast epithelium | 0.035019 |
| ENCSR000AAM | pulmonary artery endothelial cell | 0.03323 |
| ENCSR000CUR | melanocyte of skin | 0.032617 |
| ENCSR000AEC | GM12878 | 0.032569 |
| ENCSR653DFZ | G401 | 0.032011000000000005 |
| ENCSR362HMX | pericardium fibroblast | 0.030218000000000002 |
| ENCSR000CUG | vein endothelial cell | 0.030119999999999997 |
| ENCSR897KTO | epithelial cell of alveolus of lung | 0.027694 |
| ENCSR000CPM | fibroblast of lung | 0.026070999999999997 |
| ENCSR371VGV | myometrial cell | 0.021746 |
| ENCSR000CUQ | melanocyte of skin | 0.019299 |
| ENCSR000CPP | HeLa-S3 | 0.018456999999999998 |
| ENCSR000CTL | A549 | 0.018412 |
| ENCSR000CUA | hematopoietic multipotent progenitor cell | 0.017223 |
| ENCSR000AAR | tracheal epithelial cell | 0.016909 |
| ENCSR000AFF | skeletal muscle tissue | 0.011256 |
| ENCSR082UWF | K562 | 0.001407 |
| ENCSR644AIM | HepG2 | 0.0005549999999999999 |
| ENCSR450VQO | HepG2 | 0.000528 |
| ENCSR835RMN | K562 | 0.000491 |
| ENCSR092WKG | K562 | 0.00011100000000000001 |
| ENCSR843LYF | K562 | 8.4e-05 |
| ENCSR110ZYD | HepG2 | 2.3e-05 |
| ENCSR354XQY | HepG2 | 1.9e-05 |
| ENCSR829EFL | K562 | 7.000000000000001e-06 |
| ENCSR192BPV | K562 | 5e-06 |
| ENCSR745WVZ | K562 | 2e-06 |
| ENCSR898OPN | K562 | 1e-06 |
>MSTRG.22374.144
TGCCCACAAGGATCCAAGCTACTGGCTGCATCGAGGTGAGGGGTGAAGGGTCTGTGCTAGATCAAAAGGCACGGGGTGGCGATGTGGCAGAGAAGTTGCTTGTGGGGAGACCTTGCTTTTAACAGGCTTCTGGAAAAGCTAGGGAAAAGTGGTTGCCCGCTTTCCCCCTTTCCCTCCCCTTCAAGCACCGCTTGAGATTTGGGCTTTATTATTAAGAGCTGCTATAAAAACAGCTTGCTTAAATGTTAAGAGAAGCCCAGGGGTACTTCAAGCATTCCTTCGGATGCTTCACTCCAGAAAGAGGGAGCTGACACTTCTCTTGACCTTAGGATAATAGCGCTTTGTTGTCTCTCCTGCCACAGGAAGGCTCCATGGTTGTCCTACTTTAAGCCTTCGGTGCCTTTAGTGAGGGGTACCTGAAAAATCTTAAAAAAAGGCTTAGCGCCCACCTCACCCCTCCACCCCCACGCCAACACAGTTTGCTCACATGCCAG
| Disease | PMID | Dysfunction_type | Data source |
| gallbladder cancer | 27420766 | expression | PMC6372806 |
| gastric cancer | 27887846 | expression | PMC6372806 |
| renal cell carcinoma | 25480417 | expression | PMC6372806 |
| gastric cancer | 28942451 | regulated | PMC6372806 |
| endometrial cancer | 27693631 | expression | PMC6372806 |
| esophageal cancer | 25613496 | regulated | PMC6372806 |
| osteosarcoma | 25431257 | regulated | PMC6372806 |
| 25773124 | PMC6372806 | ||
| hepatocellular carcinoma | 28469957 | expression | PMC6372806 |
| osteosarcoma | 28346809 | expression | PMC6372806 |
| renal cell carcinoma | 25600645 | expression | PMC6372806 |
| 28535533 | expression | PMC6372806 | |
| bladder cancer | 24449823 | expression | PMC6372806 |
| gastric cancer | 27259812 | expression | PMC6372806 |
| breast cancer | 28915533 | expression | PMC6372806 |
| breast cancer | 26917489 | regulated | PMC6372806 |
| 26335021 | PMC6372806 | ||
| gastric cancer | 25280565 | expression | PMC6372806 |
| hepatocellular carcinoma | 21678027 | expression | PMC6372806 |
| colorectal cancer | 25025966 | expression | PMC6372806 |
| cholangiocarcinoma | 28059437 | expression | PMC6372806 |
| multiple myeloma | 28295550 | expression | PMC6372806 |
| tongue cancer | 28260102 | expression | PMC6372806 |
| glioma | 26619802 | expression | PMC6372806 |
| cervical cancer | 26242259 | expression | PMC6372806 |
| colorectal cancer | 25446987 | expression | PMC6372806 |
| mantle cell lymphoma | 27998273 | expression | PMC6372806 |
| cervical cancer | 26798987 | expression | PMC6372806 |
| colorectal cancer | 28069878 | expression | PMC6372806 |
| thyroid cancer | 27470543 | expression | PMC6372806 |
| bladder cancer | 28648755 | expression | PMC6372806 |
| oral squamous cell carcinoma | 28926115 | expression | PMC6372806 |
| hepatocellular carcinoma | 28543721 | expression | PMC6372806 |
| prostate cancer | 23845456 | expression | PMC6372806 |
| gastric cancer | 28276823 | expression | PMC6372806 |
| bladder cancer | 23153939 | expression | PMC6372806 |
| non-small-cell lung cancer | 25217850 | expression | PMC6372806 |
| renal cell carcinoma | 27655020 | expression | PMC6372806 |
| choriocarcinoma | 29096355 | expression | PMC6372806 |
| oral squamous cell carcinoma | 26522444 | expression | PMC6372806 |
| breast cancer | 27197265 | expression | PMC6372806 |
| lung cancer | 23243023 | expression | PMC6372806 |
| hypertension | 28056547 | expression | PMC6372806 |
| hepatocellular carcinoma | 24468535 | expression | PMC6372806 |
| pancreatic cancer | 25269958 | expression | PMC6372806 |
| osteosarcoma | 26575981 | expression | PMC6372806 |
| breast cancer | 26676637 | expression | PMC6372806 |
| thyroid cancer | 28543663 | expression | PMC6372806 |
| hepatocellular carcinoma | 28720061 | expression | PMC6372806 |
| multiple myeloma | 25187517 | expression | PMC6372806 |
| tongue cancer | 27586393 | expression | PMC6372806 |
| gastric cancer | 28268166 | expression | PMC6372806 |
| calcific aortic valve disease | 28522163 | expression | PMC6372806 |
| esophageal cancer | 26493997 | expression | PMC6372806 |
| pancreatic cancer | 28701723 | expression | PMC6372806 |
| osteosarcoma | 28098894 | expression | PMC6372806 |
| liver fibrosis | 26435214 | expression | PMC6372806 |
| endometrial cancer | 25085246 | regulated | PMC6372806 |
| nasopharyngeal carcinoma | 27584791 | regulated | PMC6372806 |
| esophageal cancer | 27935117 | expression | PMC6372806 |
| colorectal cancer | 29436635 | expression | PMC6372806 |
| lung cancer | 28615056 | regulated | PMC6372806 |
| esophageal cancer | 27470544 | expression | PMC6372806 |
| glioma | 26938295 | expression | PMC6372806 |
| osteoarthritis | 28590075 | expression | PMC6372806 |
| hepatocellular carcinoma | 28722813 | expression | PMC6372806 |
| 29051139 | expression | PMC6372806 | |
| gallbladder cancer | 29058818 | expression | PMC6372806 |
| retinoblastoma | 29073720 | expression | PMC6372806 |
| diabetes mellitus | 29110299 | expression | PMC6372806 |
| 22487937 | expression | PMC6372806 | |
| multiple myeloma | 24583225 | expression | PMC6372806 |
| Parkinson's disease | 27021022 | expression | PMC6372806 |
| glioma | 29202181 | expression | PMC6372806 |
| osteosarcoma | 29204769 | expression | PMC6372806 |
| multiple myeloma | 29214735 | expression | PMC6372806 |
| non-small-cell lung cancer | 29215698 | expression | PMC6372806 |
| pancreatic cancer | 29215734 | expression | PMC6372806 |
| colon cancer | 29226325 | expression | PMC6372806 |
| 29227193 | expression | PMC6372806 | |
| 29258822 | expression | PMC6372806 | |
| 29274336 | expression | PMC6372806 | |
| osteosarcoma | 29290771 | expression | PMC6372806 |
| esophageal squamous cell carcinoma | 25538231 | regulation | PMC5753334 |
| gallbladder cancer | 24658096 | regulation | PMC5753334 |
| colon cancer | 25546229 | regulation | PMC5753334 |
| colorectal cancer | 25031737 | regulation | PMC5753334 |
| bladder cancer | 24373479 | regulation | PMC5753334 |
| breast cancer | 22492512 | regulation | PMC5753334 |
| breast cancer | 22996375 | regulation | PMC5753334 |
| breast cancer | 24499465 | regulation | PMC5753334 |
| cancer | 23463798 | regulation | PMC5753334 |
| cancer | 24757675 | regulation | PMC5753334 |
| tumor | 24721780 | regulation | PMC5753334 |
| prostate cancer | 23726266 | PMC5753334 | |
| cervical cancer | 24932303 | PMC5753334 | |
| pancreatic ductal adenocarcinoma | 24815433 | PMC5753334 | |
| nasopharyngeal carcinoma | 23688988 | PMC5753334 | |
| bladder cancer | 22722759 | PMC5753334 | |
| gastric cancer | 24857172 | PMC5753334 | |
| colorectal cancer | 24244343 | PMC5753334 | |
| melanoma | 24892958 | PMC5753334 | |
| breast cancer | 24525122 | PMC5753334 | |
| neuroblastoma | 24742640 | PMC5753334 | |
| prostate cancer | 22349460 | PMC5753334 | |
| osteosarcoma | 17660802 | PMC5753334 | |
| non-small cell lung cancer | 24313945 | PMC5753334 | |
| multiple myeloma | 25369863 | PMC5753334 | |
| breast cancer | 26918449 | PMC5753334 | |
| breast cancer | 26926567 | PMC5753334 | |
| gastric cancer | 26871474 | PMC5753334 | |
| acute myocardial infarction | 25035150 | PMC5753334 | |
| diabetes mellitus | 25356875 | PMC5753334 | |
| glioblastoma | 25772239 | PMC5753334 | |
| ovarian cancer | 24379988 | PMC5753334 | |
| esophageal squamous cell carcinoma | 27015363 | PMC5753334 | |
| colorectal cancer | 21503572 | PMC5753334 | |
| lung cancer | 22491206 | PMC5753334 | |
| hepatocelluar carcinoma | 22493738 | mutation | PMC5753334 |
| paraspeckle disintegration | 19188602 | mutation | PMC5753334 |
| renal cancer | 26461224 | interaction | PMC5753334 |
| nasopharyngeal carcinoma | 26482776 | interaction | PMC5753334 |
| cervical cancer | 26311052 | interaction | PMC5753334 |
| non-small cell lung cancer | 26265046 | interaction | PMC5753334 |
| lung cancer | 26415832 | interaction | PMC5753334 |
| "hepatocellular carcinoma | |||
| prostate cancer | 26516927 | interaction | PMC5753334 |
| cervical cancer | 20213048 | Interaction | PMC5753334 |
| non-small-cell lung cancer | 25036876 | interaction | PMC5753334 |
| breast cancer | 26191181 | interaction | PMC5753334 |
| pre-eclampsia | 26722461 | interaction | PMC5753334 |
| breast cancer | 26275461 | interaction | PMC5753334 |
| glioma | 26649728 | interaction | PMC5753334 |
| lung adenocarcinoma | 20937273 | interaction | PMC5753334 |
| cervical cancer | 26400521 | expression | PMC5753334 |
| proliferative vitreoretinopathy | 26241674 | expression | PMC5753334 |
| gastric cancer | 26096073 | expression | PMC5753334 |
| non-small cell lung cancer | 26131129 | expression | PMC5753334 |
| non-small cell lung cancer | 22088988 | expression | PMC5753334 |
| triple-negative breast cancer | 25996380 | expression | PMC5753334 |
| hepatocelluar carcinoma | 16878148 | expression | PMC5753334 |
| pancreatic cancer | 25811929 | expression | PMC5753334 |
| pituitary adenoma | 24469926 | expression | PMC5753334 |
| pancreatic cancer | 25481511 | expression | PMC5753334 |
| glioma | 25613066 | expression | PMC5753334 |
| non-small cell lung cancer | 12970751 | expression | PMC5753334 |
| esophageal squamous cell carcinoma | 26406400 | expression | PMC5753334 |
| laryngeal squamous cell carcinoma | 25257554 | expression | PMC5753334 |
| endometrial stromal sarcoma | 16441420 | expression | PMC5753334 |
| bladder cancer | 24006935 | expression | PMC5753334 |
| cancer | 20711585 | expression | PMC5753334 |
| cancer | 20864030 | expression | PMC5753334 |
| cancer | 23660942 | expression | PMC5753334 |
| decreased myogenesis | 23485710 | expression | PMC5753334 |
| diabetes mellitus | 24436191 | expression | PMC5753334 |
| hepatocelluar carcinoma | 17006932 | expression | PMC5753334 |
| hepatocelluar carcinoma | 24183851 | expression | PMC5753334 |
| lung adenocarcinoma | 19690017 | expression | PMC5753334 |
| lung cancer | 24667321 | expression | PMC5753334 |
| non-small cell lung cancer | 21550244 | expression | PMC5753334 |
| non-small cell lung cancer | 21903344 | expression | PMC5753334 |
| non-small cell lung cancer | 22817756 | expression | PMC5753334 |
| osteosarcoma | 20951849 | expression | PMC5753334 |
| small cell lung cancer | 22928560 | expression | PMC5753334 |
| papillary thyroid carcinoma | 25997963 | expression | PMC5753334 |
| neuroblastoma | 20149803 | expression | PMC5753334 |
| lung cancer | 26137228 | expression | PMC5753334 |
| laryngeal squamous cell carcinoma | 24817925 | expression | PMC5753334 |
| Level of interaction | Type | Target | PMID | Data source |
| DNA-TF | regulation | CREB | 20149803 | PMC5753334 |
| RNA-Protein | binding | SR | 20797886 | PMC5753334 |
| RNA-Protein | binding | SR proteins | 20797886 | PMC5753334 |
| RNA-Protein | regulation | SR protein family | 20864030 | PMC5753334 |
| RNA-Protein | regulation | SRSF1 | 20864030 | PMC5753334 |
| RNA-Protein | binding | p54nrb | 21444682 | PMC5753334 |
| RNA-Protein | binding | PSF | 21444682 | PMC5753334 |
| DNA-Protein | regulation | Pc2 | 22078878 | PMC5753334 |
| DNA-Protein | regulation | Pc2 | 22078878 | PMC5753334 |
| RNA-Protein | regulation | RNPS1 | 22355166 | PMC5753334 |
| RNA-Protein | regulation | SRm160 | 22355166 | PMC5753334 |
| RNA-Protein | regulation | IBP160 | 22355166 | PMC5753334 |
| RNA-Protein | regulation | pre-mRNA splicing factors | 23698766 | PMC5753334 |
| RNA-DNA | regulation | Bcl-2 | 25036876 | PMC5753334 |
| RNA-DNA | binding | Sp1 and LTBP3 promoter | 25187517 | PMC5753334 |
| regulation | Cisplatin and paclitaxel | 25257554 | PMC5753334 | |
| RNA-RNA | regulation | SiRNA | 25280565 | PMC5753334 |
| RNA-Protein | regulation | PI3K/AKT signaling pathway | 25431257 | PMC5753334 |
| RNA-RNA | regulation | miR-101 and miR-217 | 25538231 | PMC5753334 |
| RNA-Protein | regulation | CCL5 | 25546229 | PMC5753334 |
| RNA-Protein | regulation | ATM-CHK2 pathway | 25613496 | PMC5753334 |
| RNA-Protein | regulation | RANKL | 25817340 | PMC5753334 |
| regulation | PI3K-AKT pathway | 26191181 | PMC5753334 | |
| RNA-RNA | regulation | miRNA-124 | 26242259 | PMC5753334 |
| RNA-Protein | binding | TDP-43 | 26265046 | PMC5753334 |
| RNA-RNA | regulation | hsa-miR-1 | 26275461 | PMC5753334 |
| RNA-RNA | regulation | miR-145 | 26311052 | PMC5753334 |
| DNA-Protein | regulation | Sp1/3 | 26352013 | PMC5753334 |
| RNA-Protein | regulation | EZH2 (enhancer of zeste homolog 2) and H3K27me3 | 26415832 | PMC5753334 |
| DNA-RNA | regulation | miR-217 | 26415832 | PMC5753334 |
| RNA-RNA | binding | miR-200s | 26461224 | PMC5753334 |
| RNA-RNA | regulation | miR-1 | 26482776 | PMC5753334 |
| RNA-Protein | binding | EZH2 | 26516927 | PMC5753334 |
| RNA-Protein | regulation | N-cadherin, Vimentin, E-cadherin | 26522444 | PMC5753334 |
| RNA-Protein | regulation | ZO-1, occludin and claudin-5 | 26619802 | PMC5753334 |
| RNA-RNA | regulation | miR-140 | 26619802 | PMC5753334 |
| regulation | ERK/MAPK signaling | 26649728 | PMC5753334 | |
| RNA-Protein | regulation | Sox2 and Nestin | 26649728 | PMC5753334 |
| RNA-RNA | regulation | Hsa-miR-1 | 26676637 | PMC5753334 |
| RNA-Protein | regulation | pro-apoptotic proteins including cleaved caspase-3, cleaved caspase-9 and cleaved poly (ADP-ribose) | 26722461 | PMC5753334 |
| RNA-DNA | regulation | PCDH10 | 26871474 | PMC5753334 |
| RNA-Protein | binding | EZH2 | 26871474 | PMC5753334 |
| RNA-RNA | binding | miR-124 | 26918449 | PMC5753334 |
| RNA-DNA | regulation | cyclin-dependent kinase 4 (CDK4) | 26918449 | PMC5753334 |
| RNA-DNA | regulation | cdc42 | 26926567 | PMC5753334 |
| RNA-RNA | binding | miR-1 | 26926567 | PMC5753334 |
| Conserved in: | 7 species |
| Not found in: | 4 species |
| Most distant counterpart in: | Marmoset |
| Conserved species: | Chimp, Rhesus, Crab-eating macaque, Atys, Baboon, Green monkey, Marmoset |
| Not found in: | Bonobo, Gorilla, Orangutan, Lemur |
Human non-coding transcript
Open the region of interest in the ENSEMBL Browser
ENSEMBL BrowserCheck the reference ENSEMBL
transcript ID
Open the region of interest in the UCSC Genome Browser