MSTRG.22374.32
Human non-coding transcript
Reference
| Relation to reference | Exonic overlap with reference on the opposite strand |
| Reference ENSEMBL ID | ENST00000534336 |
| Reference alias | MALAT1 |
| Biotype of reference transcript | lincRNA |
| Reference Gene ID | ENSG00000251562 |
Isoforms
ENSG00000251562 MSTRG.22374.97 MSTRG.22375.13 MSTRG.22375.14 MSTRG.22375.19 ENST00000544868 MSTRG.22374.32 MSTRG.22374.15 MSTRG.22374.103 MSTRG.22374.72 MSTRG.22374.13 MSTRG.22374.55 MSTRG.22374.56 MSTRG.22374.50 MSTRG.22374.52 MSTRG.22374.59 MSTRG.22374.38 ENST00000618925 MSTRG.22375.87 MSTRG.22375.81 MSTRG.22375.62 MSTRG.22375.69 MSTRG.22375.44 MSTRG.22375.49 ENST00000617791 MSTRG.22375.28 MSTRG.22375.22 MSTRG.22375.20 MSTRG.22375.21 ENST00000619449 ENST00000616691 MSTRG.22374.83 ENST00000610851 MSTRG.22374.138 ENST00000618132 MSTRG.22374.116 MSTRG.22374.117 MSTRG.22374.119 MSTRG.22374.69 MSTRG.22375.97 MSTRG.22374.12 MSTRG.22374.144 ENST00000616527 ENST00000620902 MSTRG.22375.2 MSTRG.22375.56 MSTRG.22375.52 ENST00000508832 MSTRG.22375.34 MSTRG.22374.6 MSTRG.22374.8 MSTRG.22374.9
lncRNA
| Transcript ID | MSTRG.22374.32 |
| Chromosome | 11 |
| Start | 65502311 |
| Stop | 65502814 |
| Strand | - |
| Exons | 2 |
| Length | 295 nt |
| Protein coding potential | Low |
Expession
| Sample ID | Sample type | Expression (TPM) |
|---|---|---|
| ENCSR474TRG | esophagus squamous epithelium | 561.539872 |
| ENCSR080HPT | omental fat pad | 484.75193600000006 |
| ENCSR150QJY | subcutaneous adipose tissue | 417.387705 |
| ENCSR000CVT | GM12878 | 413.591224 |
| ENCSR796HLX | tibial nerve | 376.013893 |
| ENCSR108MAU | suprapubic skin | 355.12019300000003 |
| ENCSR645TCG | omental fat pad | 328.47878 |
| ENCSR729CAZ | omental fat pad | 316.764882 |
| ENCSR485WBR | gastroesophageal sphincter | 313.02935099999996 |
| ENCSR438YPF | breast epithelium | 265.37215499999996 |
| ENCSR158KFO | omental fat pad | 250.300955 |
| ENCSR094VRQ | breast epithelium | 230.280859 |
| ENCSR035SKV | gastroesophageal sphincter | 224.72388999999998 |
| ENCSR313COD | upper lobe of left lung | 221.685951 |
| ENCSR504NIU | subcutaneous adipose tissue | 196.67116000000001 |
| ENCSR528ZKN | gastroesophageal sphincter | 182.317353 |
| ENCSR434TEU | breast epithelium | 180.195718 |
| ENCSR630VJN | transverse colon | 178.050143 |
| ENCSR800WIY | transverse colon | 174.25866399999998 |
| ENCSR463JBR | CD4-positive helper T cell | 170.329225 |
| ENCSR244ISQ | neural progenitor cell | 165.235869 |
| ENCSR257NIR | Peyer's patch | 149.390927 |
| ENCSR861QKF | CD8-positive alpha-beta T cell | 145.083833 |
| ENCSR000CUE | articular chondrocyte of knee joint | 141.379524 |
| ENCSR862RGX | suprapubic skin | 140.229524 |
| ENCSR648OSR | tibial nerve | 138.41557 |
| ENCSR351OTL | esophagus squamous epithelium | 134.817081 |
| ENCSR908ZAS | hepatocyte | 132.3924 |
| ENCSR495HDM | prostate gland | 131.259423 |
| ENCSR894WMQ | myocyte | 123.06486000000001 |
| ENCSR995JXE | neural cell | 120.122197 |
| ENCSR067UNX | HT1080 | 119.88134299999999 |
| ENCSR510MIA | esophagus squamous epithelium | 115.78635 |
| ENCSR967JPI | gastrocnemius medialis | 114.92186699999999 |
| ENCSR527SSD | foreskin keratinocyte | 109.91599199999999 |
| ENCSR740YMS | gastroesophageal sphincter | 109.57114299999999 |
| ENCSR000AAU | smooth muscle cell of the umbilical artery | 106.97644199999999 |
| ENCSR000AAS | smooth muscle cell of trachea | 104.146394 |
| ENCSR858QEL | tibial nerve | 103.401957 |
| ENCSR959LTT | foreskin keratinocyte | 99.445313 |
| ENCSR000AEZ | heart | 99.002748 |
| ENCSR000AFN | uterus | 98.19852 |
| ENCSR042GYH | ovary | 90.964438 |
| ENCSR406SAW | upper lobe of left lung | 88.345147 |
| ENCSR201WVA | SK-MEL-5 | 79.72937900000001 |
| ENCSR182CBU | esophagus muscularis mucosa | 76.849369 |
| ENCSR708VVE | subcutaneous adipose tissue | 76.67659 |
| ENCSR000CPY | K562 | 73.075789 |
| ENCSR000CUK | thoracic aorta endothelial cell | 71.631263 |
| ENCSR878EUT | glomerular endothelial cell | 70.99965300000001 |
| ENCSR460YCS | lower leg skin | 70.713848 |
| ENCSR066FZL | large intestine | 69.70936999999999 |
| ENCSR620LQN | esophagus muscularis mucosa | 69.63220600000001 |
| ENCSR292TAP | neural cell | 65.71063000000001 |
| ENCSR450BNZ | Peyer's patch | 64.151415 |
| ENCSR571RXE | right atrium auricular region | 59.57580600000001 |
| ENCSR812AKX | sigmoid colon | 56.1962 |
| ENCSR671WMH | subcutaneous adipose tissue | 55.066393999999995 |
| ENCSR272UNO | tibial nerve | 53.195907 |
| ENCSR450ENK | suprapubic skin | 51.673579 |
| ENCSR750ETS | esophagus muscularis mucosa | 45.587925 |
| ENCSR653ZJF | transverse colon | 44.174569 |
| ENCSR482VRI | small intestine | 43.022028000000006 |
| ENCSR480SLD | suprapubic skin | 41.164322999999996 |
| ENCSR841ADZ | ovary | 40.39131 |
| ENCSR609NZM | gastrocnemius medialis | 39.916391 |
| ENCSR628JYB | K562 | 39.567807 |
| ENCSR944FLL | CD8-positive alpha-beta T cell | 39.109320000000004 |
| ENCSR334HNJ | K562 | 38.010544 |
| ENCSR678TMV | gastrocnemius medialis | 37.733206 |
| ENCSR000CUB | hair follicle dermal papilla cell | 37.334086 |
| ENCSR226KML | right lobe of liver | 37.312607 |
| ENCSR098BUF | esophagus muscularis mucosa | 37.009993 |
| ENCSR802HPM | Peyer's patch | 36.197977 |
| ENCSR000CUN | mammary epithelial cell | 33.347219 |
| ENCSR919MZM | endometrial microvascular endothelial cells | 29.891559 |
| ENCSR207QGW | K562 | 29.732771000000003 |
| ENCSR000AEU | liver | 29.677344 |
| ENCSR332DBS | LHCN-M2 | 29.528789 |
| ENCSR330UMQ | spleen | 28.216654 |
| ENCSR000AAV | uterine smooth muscle cell | 27.184403000000003 |
| ENCSR373BDG | kidney epithelial cell | 26.775765000000003 |
| ENCSR034RPU | foreskin keratinocyte | 26.528979 |
| ENCSR000AHH | heart | 25.830884 |
| ENCSR000CPJ | keratinocyte | 25.16777 |
| ENCSR000CUF | osteoblast | 24.283576 |
| ENCSR391VGU | heart left ventricle | 24.235112 |
| ENCSR110BDY | cardiac atrium fibroblast | 24.049135 |
| ENCSR274KWA | HepG2 | 24.043206 |
| ENCSR797BPP | fibroblast of arm | 23.88971 |
| ENCSR653DFZ | G401 | 22.570693 |
| ENCSR900SGE | spleen | 22.325612 |
| ENCSR239BCO | K562 | 21.364380999999998 |
| ENCSR544SAU | Peyer's patch | 18.331971 |
| ENCSR000CUH | fibroblast of dermis | 18.038666 |
| ENCSR000AFI | stomach | 17.578238 |
| ENCSR504QMK | right lobe of liver | 17.400872 |
| ENCSR961WVL | K562 | 17.283358 |
| ENCSR000AAQ | renal cortical epithelial cell | 17.079376999999997 |
| ENCSR815UVL | mammary microvascular endothelial cell | 16.555651 |
| ENCSR436QDU | heart left ventricle | 16.03556 |
| ENCSR754WLW | adrenal gland | 15.854669 |
| ENCSR495YSS | K562 | 15.016091000000001 |
| ENCSR113HQM | uterus | 14.705289000000002 |
| ENCSR129RWD | K562 | 14.465085 |
| ENCSR792CBM | K562 | 14.289829999999998 |
| ENCSR052FJA | smooth muscle cell | 13.935510999999998 |
| ENCSR000CTO | MCF-7 | 13.863767999999999 |
| ENCSR728BOL | HepG2 | 13.130358 |
| ENCSR312HJY | K562 | 13.127875 |
| ENCSR680USE | hair follicular keratinocyte | 12.734283999999999 |
| ENCSR481AYC | HepG2 | 12.653516 |
| ENCSR898NWE | K562 | 12.574162 |
| ENCSR279HMU | HepG2 | 12.397378999999999 |
| ENCSR719PXC | ascending aorta | 12.350242 |
| ENCSR827IXS | sigmoid colon | 12.126833999999999 |
| ENCSR547NWD | HepG2 | 12.028444 |
| ENCSR610AEI | HepG2 | 11.981923 |
| ENCSR637JLM | HepG2 | 11.945988999999999 |
| ENCSR056QEW | K562 | 11.900117 |
| ENCSR551NII | lower leg skin | 11.777475 |
| ENCSR369RVN | cardiac ventricle fibroblast | 11.458378999999999 |
| ENCSR000CUD | mesenchymal stem cell of the bone marrow | 11.405526 |
| ENCSR648QFY | K562 | 11.327514 |
| ENCSR938LSP | GM23338 | 11.130875 |
| ENCSR194HVU | spleen | 10.91473 |
| ENCSR000COY | skeletal muscle myoblast | 10.88508 |
| ENCSR012DAF | HepG2 | 10.780302 |
| ENCSR000CUG | vein endothelial cell | 10.63054 |
| ENCSR313CHR | HepG2 | 10.558436 |
| ENCSR897KTO | epithelial cell of alveolus of lung | 10.029978999999999 |
| ENCSR000CPT | MCF-7 | 9.611121 |
| ENCSR000CPB | endothelial cell of umbilical vein | 9.344623 |
| ENCSR968WKR | bipolar neuron | 9.229965 |
| ENCSR016IDR | HepG2 | 9.216498 |
| ENCSR444WHQ | skeletal muscle myoblast | 8.860155 |
| ENCSR732ICL | K562 | 8.663611999999999 |
| ENCSR625QJI | NCI-H460 | 8.658757000000001 |
| ENCSR000AFH | spinal cord | 8.210283 |
| ENCSR425RGZ | upper lobe of left lung | 8.190161999999999 |
| ENCSR815JDY | HepG2 | 8.171736 |
| ENCSR000AEW | cerebellum | 7.836923 |
| ENCSR674KDQ | HepG2 | 7.828674 |
| ENCSR354QPN | esophagus squamous epithelium | 7.751969 |
| ENCSR560AYQ | K562 | 7.559315 |
| ENCSR357XTU | natural killer cell | 7.530530000000001 |
| ENCSR000CPM | fibroblast of lung | 7.5240339999999994 |
| ENCSR030ARO | HepG2 | 7.508380000000001 |
| ENCSR321PGV | lower leg skin | 7.277569000000001 |
| ENCSR000CUL | fibroblast of villous mesenchyme | 7.123496 |
| ENCSR064DXG | HepG2 | 7.110388 |
| ENCSR100SIL | foreskin keratinocyte | 7.078075999999999 |
| ENCSR850CKU | HepG2 | 7.020734 |
| ENCSR778RWJ | HepG2 | 6.976758 |
| ENCSR639LKS | HepG2 | 6.874889 |
| ENCSR147ZBD | HepG2 | 5.982507 |
| ENCSR237YZT | HepG2 | 5.952051 |
| ENCSR330YOU | HepG2 | 5.861351 |
| ENCSR880EGO | SJSA1 | 5.811243 |
| ENCSR856ZRV | HepG2 | 5.79662 |
| ENCSR769GES | HepG2 | 5.770894999999999 |
| ENCSR354XQY | HepG2 | 5.568266 |
| ENCSR094GVZ | sigmoid colon | 5.374569 |
| ENCSR118VQR | HepG2 | 5.335071 |
| ENCSR193FFA | HepG2 | 5.239648000000001 |
| ENCSR000CUI | skeletal muscle satellite cell | 5.205126 |
| ENCSR409CSO | HepG2 | 4.9982050000000005 |
| ENCSR000CUO | mesenchymal stem cell of Wharton's jelly | 4.958141 |
| ENCSR009PPI | HepG2 | 4.9433169999999995 |
| ENCSR455VZH | HepG2 | 4.864117 |
| ENCSR919QJT | H4 | 4.798394999999999 |
| ENCSR744YVR | HepG2 | 4.709925 |
| ENCSR029LGJ | K562 | 4.650273 |
| ENCSR343DHN | HepG2 | 4.602304 |
| ENCSR457ENP | right atrium auricular region | 4.51893 |
| ENCSR545MEZ | CD4-positive helper T cell | 4.492058999999999 |
| ENCSR152MON | HepG2 | 4.4771 |
| ENCSR057GCF | HepG2 | 4.397879 |
| ENCSR000CTX | pericyte cell | 4.397443 |
| ENCSR220TBR | HepG2 | 4.390603 |
| ENCSR000AFG | skin of body | 4.372077 |
| ENCSR253DCB | K562 | 4.163069999999999 |
| ENCSR000CTZ | mesenchymal stem cell of adipose | 4.138681 |
| ENCSR998MZP | HepG2 | 3.836732 |
| ENCSR148MQK | HepG2 | 3.7494300000000003 |
| ENCSR362HMX | pericardium fibroblast | 3.714375 |
| ENCSR067LLB | K562 | 3.707588 |
| ENCSR255NYQ | SK-N-DZ | 3.695396 |
| ENCSR004RGI | K562 | 3.680623 |
| ENCSR839ZDH | upper lobe of left lung | 3.5642720000000003 |
| ENCSR905HID | HepG2 | 3.543046 |
| ENCSR784FTX | HepG2 | 3.506646 |
| ENCSR000AFK | thyroid gland | 3.465015 |
| ENCSR952RRH | K562 | 3.437122 |
| ENCSR906RHU | K562 | 3.429164 |
| ENCSR560RSZ | K562 | 3.362565 |
| ENCSR167JPY | HepG2 | 3.3503279999999998 |
| ENCSR000CUJ | fibroblast of the aortic adventitia | 3.221098 |
| ENCSR608IAI | K562 | 3.1656590000000002 |
| ENCSR529JNJ | K562 | 3.122631 |
| ENCSR000AAL | nasal cavity respiratory epithelium epithelial cell of viscerocranial mucosa | 3.089787 |
| ENCSR840QOH | HepG2 | 3.038336 |
| ENCSR166QLP | HT1080 | 2.998278 |
| ENCSR042QTH | HepG2 | 2.930812 |
| ENCSR000AFA | metanephros | 2.873919 |
| ENCSR939ZRA | HepG2 | 2.835522 |
| ENCSR153GKS | HepG2 | 2.801483 |
| ENCSR000AFE | parietal lobe | 2.784883 |
| ENCSR000AEV | urinary bladder | 2.706955 |
| ENCSR094KBY | HepG2 | 2.6413029999999997 |
| ENCSR913CAE | K562 | 2.610009 |
| ENCSR000CPO | GM12878 | 2.526823 |
| ENCSR320BRR | RPMI-7951 | 2.477143 |
| ENCSR000AEN | K562 | 2.458357 |
| ENCSR198TKA | mesangial cell | 2.430303 |
| ENCSR792XFP | K562 | 2.4053560000000003 |
| ENCSR527IVX | K562 | 2.395012 |
| ENCSR000CPN | SK-N-SH | 2.3640470000000002 |
| ENCSR278CHI | HepG2 | 2.330334 |
| ENCSR957EEG | HepG2 | 2.2982080000000003 |
| ENCSR464ADT | K562 | 2.254207 |
| ENCSR074UZM | HepG2 | 2.244951 |
| ENCSR000CQO | keratinocyte | 2.231362 |
| ENCSR997HCQ | HepG2 | 2.190859 |
| ENCSR201WFU | K562 | 2.180895 |
| ENCSR711ZJQ | HepG2 | 2.1644919999999996 |
| ENCSR330KHN | HepG2 | 2.143815 |
| ENCSR066VOO | K562 | 2.135186 |
| ENCSR696SMK | M059J | 2.0851040000000003 |
| ENCSR624OUI | K562 | 2.07101 |
| ENCSR545AIK | K562 | 2.057677 |
| ENCSR661HEL | K562 | 2.0512650000000003 |
| ENCSR849STR | K562 | 2.046026 |
| ENCSR205VSQ | K562 | 2.034389 |
| ENCSR613SLA | foreskin keratinocyte | 1.984054 |
| ENCSR048BWH | K562 | 1.9742220000000001 |
| ENCSR361LBE | K562 | 1.9578790000000001 |
| ENCSR000AAR | tracheal epithelial cell | 1.8977099999999998 |
| ENCSR000AAN | smooth muscle cell of the pulmonary artery | 1.856107 |
| ENCSR471GIS | HepG2 | 1.823996 |
| ENCSR118TVR | epithelial cell of proximal tubule | 1.7934729999999999 |
| ENCSR891AXF | K562 | 1.757714 |
| ENCSR720BPO | HepG2 | 1.7363520000000001 |
| ENCSR000AEY | frontal cortex | 1.7195770000000001 |
| ENCSR000CTP | IMR-90 | 1.701713 |
| ENCSR246SOU | K562 | 1.6951049999999999 |
| ENCSR164OCT | NCI-H460 | 1.657501 |
| ENCSR000COK | K562 | 1.645577 |
| ENCSR146LBD | vagina | 1.643241 |
| ENCSR801MKV | adrenal gland | 1.610104 |
| ENCSR000CUM | subcutaneous preadipocyte | 1.604969 |
| ENCSR611ZAL | K562 | 1.602576 |
| ENCSR861ENA | HepG2 | 1.590961 |
| ENCSR916WOI | K562 | 1.5621120000000002 |
| ENCSR561CBC | K562 | 1.535172 |
| ENCSR978CSQ | K562 | 1.522356 |
| ENCSR000CQH | endothelial cell of umbilical vein | 1.510114 |
| ENCSR000COR | GM12878 | 1.395227 |
| ENCSR371VGV | myometrial cell | 1.385254 |
| ENCSR620NSN | bronchus fibroblast of lung | 1.372729 |
| ENCSR627NVU | K562 | 1.340463 |
| ENCSR302JQA | K562 | 1.3290540000000002 |
| ENCSR667RIA | HepG2 | 1.253068 |
| ENCSR945UYL | HepG2 | 1.221971 |
| ENCSR116YMU | HepG2 | 1.214222 |
| ENCSR222CSF | HepG2 | 1.210719 |
| ENCSR667JTA | MCF-7 | 1.210473 |
| ENCSR669KQU | SK-MEL-5 | 1.2074770000000001 |
| ENCSR871BXO | HepG2 | 1.169058 |
| ENCSR000CPR | HeLa-S3 | 1.155173 |
| ENCSR310FIS | MCF-7 | 1.13057 |
| ENCSR942MBU | HepG2 | 1.10461 |
| ENCSR331DUD | K562 | 1.099328 |
| ENCSR000CTQ | IMR-90 | 1.0973899999999999 |
| ENCSR000AFF | skeletal muscle tissue | 1.093623 |
| ENCSR136WGP | SK-N-DZ | 1.0854 |
| ENCSR237IWZ | HepG2 | 1.0767280000000001 |
| ENCSR210DML | HepG2 | 1.072497 |
| ENCSR000CQA | K562 | 1.068602 |
| ENCSR047EEG | K562 | 1.053549 |
| ENCSR947OIM | K562 | 1.015945 |
| ENCSR895BTE | K562 | 0.9852790000000001 |
| ENCSR000CUQ | melanocyte of skin | 0.9818870000000001 |
| ENCSR000CTS | SK-N-SH | 0.95155 |
| ENCSR000AFD | occipital lobe | 0.933042 |
| ENCSR047IUS | K562 | 0.9317110000000001 |
| ENCSR117WLY | K562 | 0.907127 |
| ENCSR395FYF | K562 | 0.8973770000000001 |
| ENCSR546MBH | K562 | 0.8947510000000001 |
| ENCSR134JRE | K562 | 0.894352 |
| ENCSR180XTP | HepG2 | 0.8940959999999999 |
| ENCSR675KPR | K562 | 0.876865 |
| ENCSR081EST | K562 | 0.86679 |
| ENCSR991HIR | lower leg skin | 0.8589950000000001 |
| ENCSR752UNJ | stomach | 0.8543799999999999 |
| ENCSR584LDM | K562 | 0.847483 |
| ENCSR165BCF | K562 | 0.8214040000000001 |
| ENCSR000CQM | K562 | 0.816026 |
| ENCSR101OPF | K562 | 0.808787 |
| ENCSR701TST | prostate gland | 0.806221 |
| ENCSR181RLB | K562 | 0.803685 |
| ENCSR000COO | fibroblast of lung | 0.790097 |
| ENCSR222SMI | HepG2 | 0.7854939999999999 |
| ENCSR697GLD | K562 | 0.784675 |
| ENCSR000AFB | liver | 0.784665 |
| ENCSR568YRP | SJCRH30 | 0.7756 |
| ENCSR000CQI | HeLa-S3 | 0.766193 |
| ENCSR118EFE | K562 | 0.760886 |
| ENCSR671IYC | body of pancreas | 0.759748 |
| ENCSR398GHW | K562 | 0.729142 |
| ENCSR810FHY | K562 | 0.701986 |
| ENCSR000CPH | K562 | 0.700861 |
| ENCSR410MIQ | K562 | 0.7000890000000001 |
| ENCSR143UET | K562 | 0.696427 |
| ENCSR448JAM | K562 | 0.691624 |
| ENCSR572FFX | K562 | 0.681496 |
| ENCSR234YMW | K562 | 0.6704399999999999 |
| ENCSR000CQF | GM12878 | 0.667574 |
| ENCSR000CPC | HepG2 | 0.652451 |
| ENCSR778SIU | K562 | 0.631307 |
| ENCSR119QWQ | K562 | 0.62535 |
| ENCSR000CPL | keratinocyte | 0.624359 |
| ENCSR000KYM | K562 | 0.617322 |
| ENCSR708GKW | HepG2 | 0.616911 |
| ENCSR000AED | GM12878 | 0.606622 |
| ENCSR000AAJ | dermis lymphatic vessel endothelial cell | 0.599454 |
| ENCSR000CTT | SK-N-SH | 0.598448 |
| ENCSR925RNE | K562 | 0.584667 |
| ENCSR570CWH | HepG2 | 0.58235 |
| ENCSR104OLN | HepG2 | 0.579973 |
| ENCSR904BCZ | K562 | 0.5725399999999999 |
| ENCSR964YTW | HepG2 | 0.567711 |
| ENCSR398HXV | K562 | 0.5565680000000001 |
| ENCSR000CQK | HepG2 | 0.548851 |
| ENCSR344XID | K562 | 0.5311140000000001 |
| ENCSR913ZWR | HepG2 | 0.530455 |
| ENCSR312SRB | K562 | 0.504987 |
| ENCSR000AAA | aortic smooth muscle cell | 0.503242 |
| ENCSR984CLJ | K562 | 0.49979700000000005 |
| ENCSR577XBW | K562 | 0.496334 |
| ENCSR825QXH | HepG2 | 0.49305699999999997 |
| ENCSR942UNX | K562 | 0.483954 |
| ENCSR000COZ | endothelial cell of umbilical vein | 0.478778 |
| ENCSR000AEX | diencephalon | 0.47209700000000004 |
| ENCSR927JXU | HepG2 | 0.47117 |
| ENCSR780YFF | K562 | 0.46703900000000004 |
| ENCSR783YSQ | K562 | 0.46649799999999997 |
| ENCSR256PLH | K562 | 0.456595 |
| ENCSR000CQP | SK-N-SH | 0.455201 |
| ENCSR031RZS | K562 | 0.44669899999999996 |
| ENCSR000AAM | pulmonary artery endothelial cell | 0.445816 |
| ENCSR079IPT | K562 | 0.442513 |
| ENCSR470PRV | K562 | 0.435989 |
| ENCSR185JGT | HepG2 | 0.431787 |
| ENCSR342EDG | K562 | 0.40775100000000003 |
| ENCSR000CPG | K562 | 0.40686500000000003 |
| ENCSR286OKW | K562 | 0.403223 |
| ENCSR490SQH | H7-hESC | 0.397949 |
| ENCSR961YAG | K562 | 0.395877 |
| ENCSR188IPO | K562 | 0.393125 |
| ENCSR031RRO | K562 | 0.387933 |
| ENCSR164TLB | K562 | 0.37445300000000004 |
| ENCSR000CPA | endothelial cell of umbilical vein | 0.370686 |
| ENCSR605MFS | K562 | 0.365748 |
| ENCSR367AIV | foreskin keratinocyte | 0.362466 |
| ENCSR936TED | K562 | 0.353144 |
| ENCSR000CUR | melanocyte of skin | 0.348279 |
| ENCSR580GSX | A172 | 0.33298099999999997 |
| ENCSR000AFJ | temporal lobe | 0.31889 |
| ENCSR767LLP | HepG2 | 0.31856999999999996 |
| ENCSR770OWW | K562 | 0.312654 |
| ENCSR379VXW | K562 | 0.310415 |
| ENCSR000AEO | K562 | 0.30051 |
| ENCSR691IVR | HepG2 | 0.296694 |
| ENCSR000AEM | K562 | 0.27734200000000003 |
| ENCSR776SXA | HepG2 | 0.274694 |
| ENCSR040FSN | K562 | 0.272863 |
| ENCSR000CTK | IMR-90 | 0.261288 |
| ENCSR000CPF | HepG2 | 0.24844699999999997 |
| ENCSR511BNY | K562 | 0.243025 |
| ENCSR104ABF | HepG2 | 0.23409699999999997 |
| ENCSR000COQ | GM12878 | 0.228604 |
| ENCSR110HAA | HepG2 | 0.22523200000000002 |
| ENCSR812TLY | K562 | 0.215329 |
| ENCSR385UPQ | K562 | 0.214211 |
| ENCSR191VWK | K562 | 0.212385 |
| ENCSR688GVV | K562 | 0.20347 |
| ENCSR254JJM | Daoy | 0.195193 |
| ENCSR829EFL | K562 | 0.193733 |
| ENCSR000CPS | K562 | 0.192772 |
| ENCSR603TCV | HepG2 | 0.192189 |
| ENCSR777EDL | K562 | 0.190961 |
| ENCSR454KYR | K562 | 0.186052 |
| ENCSR530BOP | K562 | 0.17995 |
| ENCSR823WTA | K562 | 0.178813 |
| ENCSR000CPQ | HeLa-S3 | 0.17598699999999998 |
| ENCSR118XYK | K562 | 0.175479 |
| ENCSR529MBZ | K562 | 0.169302 |
| ENCSR925SYZ | HepG2 | 0.153721 |
| ENCSR555BCP | adrenal gland | 0.151748 |
| ENCSR866XLI | K562 | 0.151602 |
| ENCSR835RMN | K562 | 0.151127 |
| ENCSR116QBU | HepG2 | 0.13406300000000002 |
| ENCSR000CPI | keratinocyte | 0.128613 |
| ENCSR222ABK | K562 | 0.126806 |
| ENCSR385TMY | HepG2 | 0.125804 |
| ENCSR000CUA | hematopoietic multipotent progenitor cell | 0.1123 |
| ENCSR000AAI | dermis blood vessel endothelial cell | 0.11129700000000001 |
| ENCSR000CPX | fibroblast of lung | 0.11017300000000001 |
| ENCSR000CQD | foreskin fibroblast | 0.079858 |
| ENCSR000AEE | GM12878 | 0.070871 |
| ENCSR492UFS | HepG2 | 0.067557 |
| ENCSR912EHP | HepG2 | 0.0012779999999999998 |
| ENCSR448DCX | urinary bladder | 1.4999999999999999e-05 |
FASTA
>MSTRG.22374.32
CAGATAATGTTCTCATCAGTAGTAAGAATCTCAGGCTGAACTATCACAATTCTTAATCAGTTACAATTTACAAACAGATAAGTTTAAAATAAACAATTTACAAAATTTTTGAAGCATACCTTAACATCTTGTTTTGCAGTTAAACAATGGAAAAGTATTTCTCCTACACTAAAAAAAAACTTGCTTACACACAACTGAAAATAGAATCTTACTTGATAATACAAAAGCTACCATCAGAAGAAATCCCTTCAGGATCATTAAGCCACTTCCTTTGCTCTGCAGTTTCTATAGTAGT
Disease and interactions
| Disease | PMID | Dysfunction_type | Data source |
| gallbladder cancer | 27420766 | expression | PMC6372806 |
| gastric cancer | 27887846 | expression | PMC6372806 |
| renal cell carcinoma | 25480417 | expression | PMC6372806 |
| gastric cancer | 28942451 | regulated | PMC6372806 |
| endometrial cancer | 27693631 | expression | PMC6372806 |
| esophageal cancer | 25613496 | regulated | PMC6372806 |
| osteosarcoma | 25431257 | regulated | PMC6372806 |
| 25773124 | PMC6372806 | ||
| hepatocellular carcinoma | 28469957 | expression | PMC6372806 |
| osteosarcoma | 28346809 | expression | PMC6372806 |
| renal cell carcinoma | 25600645 | expression | PMC6372806 |
| 28535533 | expression | PMC6372806 | |
| bladder cancer | 24449823 | expression | PMC6372806 |
| gastric cancer | 27259812 | expression | PMC6372806 |
| breast cancer | 28915533 | expression | PMC6372806 |
| breast cancer | 26917489 | regulated | PMC6372806 |
| 26335021 | PMC6372806 | ||
| gastric cancer | 25280565 | expression | PMC6372806 |
| hepatocellular carcinoma | 21678027 | expression | PMC6372806 |
| colorectal cancer | 25025966 | expression | PMC6372806 |
| cholangiocarcinoma | 28059437 | expression | PMC6372806 |
| multiple myeloma | 28295550 | expression | PMC6372806 |
| tongue cancer | 28260102 | expression | PMC6372806 |
| glioma | 26619802 | expression | PMC6372806 |
| cervical cancer | 26242259 | expression | PMC6372806 |
| colorectal cancer | 25446987 | expression | PMC6372806 |
| mantle cell lymphoma | 27998273 | expression | PMC6372806 |
| cervical cancer | 26798987 | expression | PMC6372806 |
| colorectal cancer | 28069878 | expression | PMC6372806 |
| thyroid cancer | 27470543 | expression | PMC6372806 |
| bladder cancer | 28648755 | expression | PMC6372806 |
| oral squamous cell carcinoma | 28926115 | expression | PMC6372806 |
| hepatocellular carcinoma | 28543721 | expression | PMC6372806 |
| prostate cancer | 23845456 | expression | PMC6372806 |
| gastric cancer | 28276823 | expression | PMC6372806 |
| bladder cancer | 23153939 | expression | PMC6372806 |
| non-small-cell lung cancer | 25217850 | expression | PMC6372806 |
| renal cell carcinoma | 27655020 | expression | PMC6372806 |
| choriocarcinoma | 29096355 | expression | PMC6372806 |
| oral squamous cell carcinoma | 26522444 | expression | PMC6372806 |
| breast cancer | 27197265 | expression | PMC6372806 |
| lung cancer | 23243023 | expression | PMC6372806 |
| hypertension | 28056547 | expression | PMC6372806 |
| hepatocellular carcinoma | 24468535 | expression | PMC6372806 |
| pancreatic cancer | 25269958 | expression | PMC6372806 |
| osteosarcoma | 26575981 | expression | PMC6372806 |
| breast cancer | 26676637 | expression | PMC6372806 |
| thyroid cancer | 28543663 | expression | PMC6372806 |
| hepatocellular carcinoma | 28720061 | expression | PMC6372806 |
| multiple myeloma | 25187517 | expression | PMC6372806 |
| tongue cancer | 27586393 | expression | PMC6372806 |
| gastric cancer | 28268166 | expression | PMC6372806 |
| calcific aortic valve disease | 28522163 | expression | PMC6372806 |
| esophageal cancer | 26493997 | expression | PMC6372806 |
| pancreatic cancer | 28701723 | expression | PMC6372806 |
| osteosarcoma | 28098894 | expression | PMC6372806 |
| liver fibrosis | 26435214 | expression | PMC6372806 |
| endometrial cancer | 25085246 | regulated | PMC6372806 |
| nasopharyngeal carcinoma | 27584791 | regulated | PMC6372806 |
| esophageal cancer | 27935117 | expression | PMC6372806 |
| colorectal cancer | 29436635 | expression | PMC6372806 |
| lung cancer | 28615056 | regulated | PMC6372806 |
| esophageal cancer | 27470544 | expression | PMC6372806 |
| glioma | 26938295 | expression | PMC6372806 |
| osteoarthritis | 28590075 | expression | PMC6372806 |
| hepatocellular carcinoma | 28722813 | expression | PMC6372806 |
| 29051139 | expression | PMC6372806 | |
| gallbladder cancer | 29058818 | expression | PMC6372806 |
| retinoblastoma | 29073720 | expression | PMC6372806 |
| diabetes mellitus | 29110299 | expression | PMC6372806 |
| 22487937 | expression | PMC6372806 | |
| multiple myeloma | 24583225 | expression | PMC6372806 |
| Parkinson's disease | 27021022 | expression | PMC6372806 |
| glioma | 29202181 | expression | PMC6372806 |
| osteosarcoma | 29204769 | expression | PMC6372806 |
| multiple myeloma | 29214735 | expression | PMC6372806 |
| non-small-cell lung cancer | 29215698 | expression | PMC6372806 |
| pancreatic cancer | 29215734 | expression | PMC6372806 |
| colon cancer | 29226325 | expression | PMC6372806 |
| 29227193 | expression | PMC6372806 | |
| 29258822 | expression | PMC6372806 | |
| 29274336 | expression | PMC6372806 | |
| osteosarcoma | 29290771 | expression | PMC6372806 |
| esophageal squamous cell carcinoma | 25538231 | regulation | PMC5753334 |
| gallbladder cancer | 24658096 | regulation | PMC5753334 |
| colon cancer | 25546229 | regulation | PMC5753334 |
| colorectal cancer | 25031737 | regulation | PMC5753334 |
| bladder cancer | 24373479 | regulation | PMC5753334 |
| breast cancer | 22492512 | regulation | PMC5753334 |
| breast cancer | 22996375 | regulation | PMC5753334 |
| breast cancer | 24499465 | regulation | PMC5753334 |
| cancer | 23463798 | regulation | PMC5753334 |
| cancer | 24757675 | regulation | PMC5753334 |
| tumor | 24721780 | regulation | PMC5753334 |
| prostate cancer | 23726266 | PMC5753334 | |
| cervical cancer | 24932303 | PMC5753334 | |
| pancreatic ductal adenocarcinoma | 24815433 | PMC5753334 | |
| nasopharyngeal carcinoma | 23688988 | PMC5753334 | |
| bladder cancer | 22722759 | PMC5753334 | |
| gastric cancer | 24857172 | PMC5753334 | |
| colorectal cancer | 24244343 | PMC5753334 | |
| melanoma | 24892958 | PMC5753334 | |
| breast cancer | 24525122 | PMC5753334 | |
| neuroblastoma | 24742640 | PMC5753334 | |
| prostate cancer | 22349460 | PMC5753334 | |
| osteosarcoma | 17660802 | PMC5753334 | |
| non-small cell lung cancer | 24313945 | PMC5753334 | |
| multiple myeloma | 25369863 | PMC5753334 | |
| breast cancer | 26918449 | PMC5753334 | |
| breast cancer | 26926567 | PMC5753334 | |
| gastric cancer | 26871474 | PMC5753334 | |
| acute myocardial infarction | 25035150 | PMC5753334 | |
| diabetes mellitus | 25356875 | PMC5753334 | |
| glioblastoma | 25772239 | PMC5753334 | |
| ovarian cancer | 24379988 | PMC5753334 | |
| esophageal squamous cell carcinoma | 27015363 | PMC5753334 | |
| colorectal cancer | 21503572 | PMC5753334 | |
| lung cancer | 22491206 | PMC5753334 | |
| hepatocelluar carcinoma | 22493738 | mutation | PMC5753334 |
| paraspeckle disintegration | 19188602 | mutation | PMC5753334 |
| renal cancer | 26461224 | interaction | PMC5753334 |
| nasopharyngeal carcinoma | 26482776 | interaction | PMC5753334 |
| cervical cancer | 26311052 | interaction | PMC5753334 |
| non-small cell lung cancer | 26265046 | interaction | PMC5753334 |
| lung cancer | 26415832 | interaction | PMC5753334 |
| "hepatocellular carcinoma | |||
| prostate cancer | 26516927 | interaction | PMC5753334 |
| cervical cancer | 20213048 | Interaction | PMC5753334 |
| non-small-cell lung cancer | 25036876 | interaction | PMC5753334 |
| breast cancer | 26191181 | interaction | PMC5753334 |
| pre-eclampsia | 26722461 | interaction | PMC5753334 |
| breast cancer | 26275461 | interaction | PMC5753334 |
| glioma | 26649728 | interaction | PMC5753334 |
| lung adenocarcinoma | 20937273 | interaction | PMC5753334 |
| cervical cancer | 26400521 | expression | PMC5753334 |
| proliferative vitreoretinopathy | 26241674 | expression | PMC5753334 |
| gastric cancer | 26096073 | expression | PMC5753334 |
| non-small cell lung cancer | 26131129 | expression | PMC5753334 |
| non-small cell lung cancer | 22088988 | expression | PMC5753334 |
| triple-negative breast cancer | 25996380 | expression | PMC5753334 |
| hepatocelluar carcinoma | 16878148 | expression | PMC5753334 |
| pancreatic cancer | 25811929 | expression | PMC5753334 |
| pituitary adenoma | 24469926 | expression | PMC5753334 |
| pancreatic cancer | 25481511 | expression | PMC5753334 |
| glioma | 25613066 | expression | PMC5753334 |
| non-small cell lung cancer | 12970751 | expression | PMC5753334 |
| esophageal squamous cell carcinoma | 26406400 | expression | PMC5753334 |
| laryngeal squamous cell carcinoma | 25257554 | expression | PMC5753334 |
| endometrial stromal sarcoma | 16441420 | expression | PMC5753334 |
| bladder cancer | 24006935 | expression | PMC5753334 |
| cancer | 20711585 | expression | PMC5753334 |
| cancer | 20864030 | expression | PMC5753334 |
| cancer | 23660942 | expression | PMC5753334 |
| decreased myogenesis | 23485710 | expression | PMC5753334 |
| diabetes mellitus | 24436191 | expression | PMC5753334 |
| hepatocelluar carcinoma | 17006932 | expression | PMC5753334 |
| hepatocelluar carcinoma | 24183851 | expression | PMC5753334 |
| lung adenocarcinoma | 19690017 | expression | PMC5753334 |
| lung cancer | 24667321 | expression | PMC5753334 |
| non-small cell lung cancer | 21550244 | expression | PMC5753334 |
| non-small cell lung cancer | 21903344 | expression | PMC5753334 |
| non-small cell lung cancer | 22817756 | expression | PMC5753334 |
| osteosarcoma | 20951849 | expression | PMC5753334 |
| small cell lung cancer | 22928560 | expression | PMC5753334 |
| papillary thyroid carcinoma | 25997963 | expression | PMC5753334 |
| neuroblastoma | 20149803 | expression | PMC5753334 |
| lung cancer | 26137228 | expression | PMC5753334 |
| laryngeal squamous cell carcinoma | 24817925 | expression | PMC5753334 |
| Level of interaction | Type | Target | PMID | Data source |
| DNA-TF | regulation | CREB | 20149803 | PMC5753334 |
| RNA-Protein | binding | SR | 20797886 | PMC5753334 |
| RNA-Protein | binding | SR proteins | 20797886 | PMC5753334 |
| RNA-Protein | regulation | SR protein family | 20864030 | PMC5753334 |
| RNA-Protein | regulation | SRSF1 | 20864030 | PMC5753334 |
| RNA-Protein | binding | p54nrb | 21444682 | PMC5753334 |
| RNA-Protein | binding | PSF | 21444682 | PMC5753334 |
| DNA-Protein | regulation | Pc2 | 22078878 | PMC5753334 |
| DNA-Protein | regulation | Pc2 | 22078878 | PMC5753334 |
| RNA-Protein | regulation | RNPS1 | 22355166 | PMC5753334 |
| RNA-Protein | regulation | SRm160 | 22355166 | PMC5753334 |
| RNA-Protein | regulation | IBP160 | 22355166 | PMC5753334 |
| RNA-Protein | regulation | pre-mRNA splicing factors | 23698766 | PMC5753334 |
| RNA-DNA | regulation | Bcl-2 | 25036876 | PMC5753334 |
| RNA-DNA | binding | Sp1 and LTBP3 promoter | 25187517 | PMC5753334 |
| regulation | Cisplatin and paclitaxel | 25257554 | PMC5753334 | |
| RNA-RNA | regulation | SiRNA | 25280565 | PMC5753334 |
| RNA-Protein | regulation | PI3K/AKT signaling pathway | 25431257 | PMC5753334 |
| RNA-RNA | regulation | miR-101 and miR-217 | 25538231 | PMC5753334 |
| RNA-Protein | regulation | CCL5 | 25546229 | PMC5753334 |
| RNA-Protein | regulation | ATM-CHK2 pathway | 25613496 | PMC5753334 |
| RNA-Protein | regulation | RANKL | 25817340 | PMC5753334 |
| regulation | PI3K-AKT pathway | 26191181 | PMC5753334 | |
| RNA-RNA | regulation | miRNA-124 | 26242259 | PMC5753334 |
| RNA-Protein | binding | TDP-43 | 26265046 | PMC5753334 |
| RNA-RNA | regulation | hsa-miR-1 | 26275461 | PMC5753334 |
| RNA-RNA | regulation | miR-145 | 26311052 | PMC5753334 |
| DNA-Protein | regulation | Sp1/3 | 26352013 | PMC5753334 |
| RNA-Protein | regulation | EZH2 (enhancer of zeste homolog 2) and H3K27me3 | 26415832 | PMC5753334 |
| DNA-RNA | regulation | miR-217 | 26415832 | PMC5753334 |
| RNA-RNA | binding | miR-200s | 26461224 | PMC5753334 |
| RNA-RNA | regulation | miR-1 | 26482776 | PMC5753334 |
| RNA-Protein | binding | EZH2 | 26516927 | PMC5753334 |
| RNA-Protein | regulation | N-cadherin, Vimentin, E-cadherin | 26522444 | PMC5753334 |
| RNA-Protein | regulation | ZO-1, occludin and claudin-5 | 26619802 | PMC5753334 |
| RNA-RNA | regulation | miR-140 | 26619802 | PMC5753334 |
| regulation | ERK/MAPK signaling | 26649728 | PMC5753334 | |
| RNA-Protein | regulation | Sox2 and Nestin | 26649728 | PMC5753334 |
| RNA-RNA | regulation | Hsa-miR-1 | 26676637 | PMC5753334 |
| RNA-Protein | regulation | pro-apoptotic proteins including cleaved caspase-3, cleaved caspase-9 and cleaved poly (ADP-ribose) | 26722461 | PMC5753334 |
| RNA-DNA | regulation | PCDH10 | 26871474 | PMC5753334 |
| RNA-Protein | binding | EZH2 | 26871474 | PMC5753334 |
| RNA-RNA | binding | miR-124 | 26918449 | PMC5753334 |
| RNA-DNA | regulation | cyclin-dependent kinase 4 (CDK4) | 26918449 | PMC5753334 |
| RNA-DNA | regulation | cdc42 | 26926567 | PMC5753334 |
| RNA-RNA | binding | miR-1 | 26926567 | PMC5753334 |
Conservation
| Conserved in: | 7 species |
| Not found in: | 4 species |
| Most distant counterpart in: | Marmoset |
| Conserved species: | Chimp, Rhesus, Crab-eating macaque, Atys, Baboon, Green monkey, Marmoset |
| Not found in: | Bonobo, Gorilla, Orangutan, Lemur |
1
2
MSTRG.22374.32
Human non-coding transcript
Open the region of interest in the ENSEMBL Browser
ENSEMBL BrowserCheck the reference ENSEMBL
transcript ID
Open the region of interest in the UCSC Genome Browser